SimpleSearch - Line and FST details


Line specific information

 
Line ID 312E06
Vector Used pAC161
Line Availability only available from NASC (N429910)
Segregation Analysis 100:99:66
Confirmed for Hit At5g66700
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g66770 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g66700

 
Sequence (A. th genome BLAST matches underlined)
>45-K015817-022-312-E06-8409
TGTCCTGANATTTCTCGGAATGAAGCCATTTACATTGAATATGTAGAGAGGATGACCAAC
TATACGCTATGGGATCCTCCCTATAGTGAGAAAATTCGAAAACTGTCGGAACGACTTGAA
GAAATGCCAACCAACAGTTCAAGTTCATCGCTTTCTGTTGAAGCCAACAATGCACCAACT
GATTTCGAGCTTGCCCCGGAAACTAATTATAACATCCCGTTTTATATGTTAGATAATAAT
TATTTACAAAGCATGGAGTATTGGGATGGTTTGTATGTATAATCAGTTTATCAACTAAAT
ATCTCGTGCTTTATTGATGCAACTCATGTTATTATAAGTAATGTAGAAATAGGTGTTGGT
GAAACGGTTGTAATTATGTGTTGTTTTCAGTATTTATTTTAATATATTACTTTGTTTATT
ATCACTTTGCTTCTTCTATGGGATCCTCCCCTAATAGTGAGGAGNNNNCGGATATTANNN
CTTCGCTGTTTTGTCTCCCTCCGCCCCTTGGAATATCCAGACTGTATCTTATGATATGAA
TCGGAGTAAACAAGCGTGTCCGTGCTCCACCCTGTTGACGAAGATTTTCTTCTTGTCCTT
GAGTCGTAAGAAACTCTGTATGAACTGGTCGCCAGTCTTTACGGGGAAGTCCTGTTAGGG
CCTCTATTTGAATCTTTGAATCCATGGGGAATGGGGGATCCTC
GenBank Accession AL948448 [GenBank]
Graphic View Graphic view of gene At5g66700
Predicted Position of Insertion Chr5:26635539 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MSN2
Hit Gene Code At5g66700 [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox 53
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g66770

 
Sequence (A. th genome BLAST matches underlined)
>46-K020163-022-312-E06t-8409
GATCCTCCCTATAGTGAGATAAAATCACCCCTATCTTTCTTTTATTTTGTCGAAAGCCCA
AAAATTGATATCGTAAATTTCTACACCCTCATTTTTTTTTGTCTTACAATATTTCTAAAA
CTTTTCGGGAGGCTGATTTATTCTGCATACCTGGATGGCTTGCAATTTCCCTATGGGATC
CTCCCTATAGGGAGACANACTCTGACCCTAACNAANCTTCCAAGACGCTTCTTCAAATCC
GAGAATCTGTATCGGAGCTAAGGGATCCGACGGAGCGAGTTGCATTTTACTTCACGGAAG
CTCTCTCCAACAGACTGTCTCCTAATTCGCCGGCGACGTCGTCTTCTTCTTCATCTACGG
AGGATTTAATCTTATCTTATAAAACCCTAAACGACGCTTGTCCTTACTCCAAATTCTTTT
ATTTGACGGCCAATCAAGCGATTCTAGAAGATACTCAAAAAAAAAAGAAGAGTCCCTTCN
NCNATTTTGGAATCGTTCAAGGTATACAATGGCCTGCTCTTCTTCAAGCCCTATGGGATC
CTCCCTATAGTGAG
GenBank Accession CT026248 [GenBank]
Graphic View Graphic view of gene At5g66770
Predicted Position of Insertion Chr5:26661182 - go to primer design
BLAST e Value 4e-122
Hit Clone Code (BAC ID) MSN2
Hit Gene Code At5g66770 [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification CDSi
Confirmation Status failed
Other FSTs Supporting this Hit CT026246 [GenBank]


Last Updated on 14.10.2014 10:23