SimpleSearch - Line and FST details


Line specific information

 
Line ID 313G08
Vector Used pAC161
Line Availability only available from NASC (N430032)
Segregation Analysis 50:38:29
Confirmed for Hit At4g21330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g21330

 
Sequence (A. th genome BLAST matches underlined)
>63-K015822-022-313-G08-8409
TGTCCTGTAGATTTCCCGGACATGAAGCCATTCACAACCGCCATGGATCTATTCTTAATA
CCGTCCTCTGTTCTCAGACATGATCTCTGAGCATGACGTCCTCATCCCAGATCTTCCTCT
TGTGACGCATTGCGCCTGTCCCCATAATAATTAATCATCATACATCGATGGAGATTAACG
AGTCCTAATTCCATTACAGTATGTTTTATATTCCTCTGTTGCGACTTTCTTCATCTCATC
TGATATCATATCTATGGGAGCCTGCGTTACAAGCACGAATGAGCTTCTTCTTGTCTTCAT
ATATGTTGCTGCAAAATGTTCATGATCCTCTGTTTGAGGTCAAAGAAAGAAAACACTATG
GGATCCCCCCTTATAGTGAG
GenBank Accession CR356304 [GenBank]
Graphic View Graphic view of gene At4g21330
Predicted Position of Insertion Chr4:11350599 - go to primer design
BLAST e Value 4e-38
Hit Clone Code (BAC ID) T6K22
Hit Gene Code At4g21330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR356304 [GenBank]


Last Updated on 31.08.2016 09:40