SimpleSearch - Line and FST details


Line specific information

 
Line ID 313H09
Vector Used pAC161
Line Availability only available from NASC (N430045)
Segregation Analysis 100:88:63
Confirmed for Hit At3g18890
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18890

 
Sequence (A. th genome BLAST matches underlined)
>72-K015818-022-313-H09-8409
TGTCATGANATTTCCCGGACATGAAGCCATTTACATTGAATCACGTACACCGGAAATTAC
GATCCACCTTCTACACCGGAACACAATTCCACCTTCTACACCGGAAGCAGTACCTGTTGT
TAGCAGTGCGATAGACACTTCCCTTGCTTCAGGAGACAATACAGCTCAGCCAAAGCCAAG
GCCTTTATCACCTTACACAATGTGAGAATAGAGAGAAGCATGCTATGGGATCCCCCCTAT
AGTGAGANNNCNNNNNNNNNNNNNNNNNNTTNNNNNNNAAANAGAANANNGCNAANCATT
TATACAATNANTAAAAATNTTATATTTATTATAATTTATAAAAAAATTTNNNATATTAAA
TTATTTTTTTATNATAAAAAATTATTTTAATAAAAAAAATTTTAAAAATAAAATAAATCA
AAATTATTCCATTATATTAAAAAAAATATCTTATAACCTCAAAACCAAAATCTTCCCCCC
TACCCCACCCCCCCTTAAAAAAATATTCCCTAATTCACACCATCACCCTCCACCTATACC
CCTCCCACCTTATTCAAAATACCACTTTACAAACCTCCCACAAAAATTTCCTCCCNCTCA
CTTTTACCCCTTAAAATATTTCACCANCCCACCCATATTTTTCNCCNCCACANCATTTCT
ATANACCCCCTCACTCCTCTCTCCCCCCCACTTAATTTATAATAATTCCCCCCTTCCCCC
ATATTTACATACCTCTTATACCATCCCACCTTACAAATAAACACCCCCCCCTACACATCA
TTTAATCTTTCCCCCTCACCCACCTTCCTTTTTCATCTCCACCAAACCCAATATTTTCTA
AC
GenBank Accession BX942951 [GenBank]
Graphic View Graphic view of gene At3g18890
Predicted Position of Insertion Chr3:6514439 - go to primer design
BLAST e Value 4e-78
Hit Clone Code (BAC ID) MCB22
Hit Gene Code At3g18890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942952 [GenBank]


Last Updated on 07.07.2016 14:03