SimpleSearch - Line and FST details


Line specific information

 
Line ID 316H10
Vector Used pAC161
Line Availability only available from NASC (N430334)
Segregation Analysis 100:84:70
Confirmed for Hit At4g27800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g27800

 
Sequence (A. th genome BLAST matches underlined)
>80-K015853-022-316-H10-8409
TGTCCTGTAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTAAAGAAAATATCT
TAACTAACTTAACGGTCCACTTTATAAGTTTTGGGCTTAGGCCCAAATCGTGATCAATCA
ACTTTTATAGCTTTCCTTTTCAGGAAAGTATTATTGCTGTCGCTATGGGATCCTCCCTAT
AGTGAGAAACACTCTCCGCCACTCAGCCTATCCTTCCGCCGACGCTGGCGGTGGCCTTGT
CGTCTATCCCACGAATGGTCGTCACCGTTGCTCCGCGATTGCGATCGACGCTCCGTCGTC
TCTGACTGGCGTGACGCCGATTCGTTGGGGTTACACGAGTGTTCAAGGATTCCGAGATGA
GATGGAAGACGACATCGTAATCCGTTCTGATGCTGTCGATAGCTTCTCCTACGCAGCGGT
CTTCGACGGCCACGCTGGGTCGTCCTCTGTCAAATTCCTCAGGTAACTTGTGTTGCTTCT
CATGCAAGCTCTGTCTTCTATGGGATC
GenBank Accession BX942954 [GenBank]
Graphic View Graphic view of gene At4g27800
Predicted Position of Insertion Chr4:13854181 - go to primer design
BLAST e Value 3e-174
Hit Clone Code (BAC ID) T27E11
Hit Gene Code At4g27800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation thylakoid-associated phosphatase 38
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03