SimpleSearch - Line and FST details


Line specific information

 
Line ID 318C08
Vector Used pAC161
Line Availability only available from NASC (N430464)
Segregation Analysis 50:41:40
Confirmed for Hit At5g54750
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g05980

 
Sequence (A. th genome BLAST matches underlined)
>59-K015855-022-318-C08-8409
TATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATTACATTGGTAATTTA
CATGTAGATTTCATACTCACGCATCACAATTTTGTTAAGCTTCCTTATTAAATACAAACT
TAATTGAATTAATAAAAAGTCTGGGTGGTGTAGTCGGTTATCACGCTATGGGATCCCCNC
TATAGTGAGACCCCCCACCCCCCCCCCGCCCGTTGNGCTCTGCCTTTTTT
GenBank Accession AL949134 [GenBank]
Graphic View Graphic view of gene At5g05980
Predicted Position of Insertion Chr5:1804536 - go to primer design
BLAST e Value 6e-43
Hit Clone Code (BAC ID) K18J17
Hit Gene Code At5g05980 [TAIR] [MIPS] [SIGnAL]
Gene Annotation DHFS-FPGS homolog B
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At5g54750

 
Sequence (A. th genome BLAST matches underlined)
>59-K015859-022-318-C08-8409
TATCATGAAATTTCCCGGACTGAAGCCTTTACAATTGAATATTACATTGGTAATTTACAT
GTACATTTCATACTCACGCATCACAATTTTGTTAAGCTTCCTTATTAAATACAAACTTAA
TTGAATTAATAAAAAGTCTGGGTGGTCGTACGTCGGTTATCAGCACTATGGGATCCTCCC
TATAGAGAGATCCAAACACTGAGCACAAACAAGTTCTGCACTTGATAATGGAGAAGGAGA
CTGACCATTTCCAAAGCTCCTCTAATGACTCCACTTAAGACATTGCAGTAGTAAAGACCT
TGGCAAGTATCGGGAAGCTCGACGAAATCAACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL949135 [GenBank]
Graphic View Graphic view of gene At5g54750
Predicted Position of Insertion Chr5:22243456 - go to primer design
BLAST e Value 4e-75
Hit Clone Code (BAC ID) K5F14
Hit Gene Code At5g54750 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transport protein particle (TRAPP) component
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23