SimpleSearch - Line and FST details


Line specific information

 
Line ID 318C09
Vector Used pAC161
Line Availability only available from NASC (N430465)
Segregation Analysis 100:100:100
Confirmed for Hit At3g27080
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g27080

 
Sequence (A. th genome BLAST matches underlined)
>67-K015859-022-318-C09-8409
TGATCTGTAATTTCCCGGACATGAAGCCATTTAAATTGAATATATCCTGCAATCCATGTA
TCATTGATGATCAAAATGTGCTGTTAGGCTATTATGTACCCGGGGACGTAAGCTGTTTGC
AATTGTAGAAGAAAATCCAAAAGTGTTGGACAAAAGAAGAAAAGCTTTGAGAAGCGTGGG
ATACTGGAAACTGAGTTCGATTGATACTATTGTTCGAACAAATTCGACAAGACGCCGAAA
ATACCTACAAGTCAAATCCTTTAGATGCCGATGTGAGTTTTCTCTTCATTTCATGATTTC
AGATGCAGTTCGATCTGATCTCTGCTTTGTGATTCGATGGCAGAAAGAAAAAAACGAATC
TTTTTGATTTTTTGTTCTTGTTGTTGCAGAATCTGACTATGGGATCCCCCCTTATAGTGA
GANNNNGNNNCNNNNNGNNNNNNCNNNNNGNNTGNNNNNNNCNNNCNGNNNNGGGCCCCC
CCNNTCTNGAAGGGCCCCCGCGCCCCCCCCGCGCCGAGGTCCGGCCCATTCGCCCCTTCT
TCCTTGCCTGGTTTCCCGCAGGACAGGACAGAGGATCTAGAACTACATTTGCGAAATGAA
GACAGCATCACCTCGCATCTCCCGGTTATACCTGTGTGTCTTTTTCAGCGCTGGCCCAAT
TTGGTAAAAGTAATAACCCAGCAACTCGAGTCTCGGATATGGGTTAGAAACCTTCTCTGC
TCTTTCACAACATTTTGGTTCATCTTTTCCATGCCACAAAGTTTATTTTCAAGTCTAATA
G
GenBank Accession BX942955 [GenBank]
Graphic View Graphic view of gene At3g27080
Predicted Position of Insertion Chr3:9986678 - go to primer design
BLAST e Value 2e-86
Hit Clone Code (BAC ID) MOJ10
Hit Gene Code At3g27080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase of outer membrane 20 kDa subunit 3
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40