SimpleSearch - Line and FST details


Line specific information

 
Line ID 318D10
Vector Used pAC161
Line Availability only available from NASC (N430478)
Segregation Analysis 100:92:64
Confirmed for Hit F14G6
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g47640 can not be ordered because the confirmation of this insertion failed.

Gene hit F14G6

 
Sequence (A. th genome BLAST matches underlined)
>76-K015859-022-318-D10-8409
TGTCCTGTAATTTCCCGGACATGAAGCCATTTACATTGAATCTTCAATCCATATCTCTCG
TTACTGCTATTGCGCTATTCGCTGTATGCCTAATATCATCTACTGTTTCAGTTTCGTCTA
TCTGAACTGACCCTAGTGGTATACTCCCCATAGAGAGATCACATTTTGACGAATAAAGAG
ATTAATGTTATCCTTTACAAAATAATGAAATAAGAAAGAAACAGAAGTTTATGTTTGTCC
AATTATCCTCAATGTTTGTTGATATACGAATTTTGAGAATTCAAACTGAATACAAGAAAT
AAAAATGTAGTGAGATAATAATACAAATTTGCATTATTTCTTCCAAGATTGTTTTCTTTA
AGTAAATGAAAAGTATCTTGGATTATTACAGAAATGACCCTAAATCTTTTTGAATTTACA
GTTTGTACCACCACCGAATAAAATAAGAAAAAGTTTCGTTAAATGTTACGAGTGCTCGTT
GAAGACGAAGTTTCGAAGACGACCAACAAAGAGAAAGATCAAATTTTGAGAGGGAAACTA
AAAAGAGGAAGAGAGAAGAAGAAGAAGAAAACCCCCTTGATTAATAAAGTCTCAGACTTT
TTTGATCCATTCCAAAAAAGGGAGTTTATGCCTTGAAGCTGGGAAATCCAAAAATCCGGA
ATTCGTGTAAAACTA
GenBank Accession AL949149 [GenBank]
Graphic View Graphic view of sequence AL949149 of line 318D10
Predicted Position of Insertion Chr1:28733798 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F14G6
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g47640

 
Sequence (A. th genome BLAST matches underlined)
>76-K015855-022-318-D10-8409
CTCTCCTCCCTATATTCCAGTAATTCATCTACTGTTTCCAGTTTCATCAATCTTAGCTGT
CTCTATGGGATCCTCCCTATAGTAGAGAAANANNNNGACGAATNNCCAGATTATTGNTAT
CCTTTACAAAATAATGAACCCACCCCGAAACAGAAGTTTATGTTCGTCCAATCATCCTCA
CTGTTTGCTGATATACGA
GenBank Accession AL949148 [GenBank]
Graphic View Graphic view of gene At2g47640
Predicted Position of Insertion Chr2:19537552 - go to primer design
BLAST e Value 1e-16
Hit Clone Code (BAC ID) T30B22
Hit Gene Code At2g47640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Small nuclear ribonucleoprotein family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 318E10


Last Updated on 14.10.2014 10:23