SimpleSearch - Line and FST details


Line specific information

 
Line ID 318G08
Vector Used pAC161
Line Availability only available from NASC (N430512)
Segregation Analysis 54:7:4
Confirmed for Hit At4g01520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g01520

 
Sequence (A. th genome BLAST matches underlined)
>63-K015859-022-318-G08-8409
TGTCCTGTAATTTCCCGGACATGAAGCCTTTACATTGAATAAAAAGAATAACCAGAGAGA
TAGAATCCGAAAAAACTTCACTCAAACCCTATATCCCGGGAACCCGGGAATTTTGATCAT
TTTGTTTCTTTTCGATCTGTTTCTATTTTAAAAAGATGATGAAAGATCCGACTGGGTATA
GATTTAGTCCGACGGGAGAGGAAGTGATAAACCATTACCTAAAGAACAAAATTCTGGGTA
AGACTTGGCTCGTTGATGAAGCCATTAGCGAGATCAACATCTTGAATCACAAACCCAGCA
AGGATTTGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL949192 [GenBank]
Graphic View Graphic view of gene At4g01520
Predicted Position of Insertion Chr4:659280 - go to primer design
BLAST e Value 2e-135
Hit Clone Code (BAC ID) F11O4
Hit Gene Code At4g01520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 67
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40