SimpleSearch - Line and FST details


Line specific information

 
Line ID 319H01
Vector Used pAC161
Line Availability only available from NASC (N430613)
Segregation Analysis 100:86:2
Confirmed for Hit At3g09910
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g09910

 
Sequence (A. th genome BLAST matches underlined)
>08-K015860-022-319-H01-8409
TATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCACCATTAA
CCATGACTGCATTAAGATGCTCGTTGGCAACAAAGTTGATAGAGTGAGTAGCAGTAGTAG
TAACACTTGTAGTCAAACAACTTGAGATCGGTTTCACTGATAGTTGTCATTGCAGGAATC
AGAAAGGAAGGTTAGCCGGGAAGAAGGAATGGCCCTATGGGATCCTCCCTATAGTGAGAC
TGCAACTTTTCTCGTCCCACTAAGATGCCTCACATCCAATGGGTCACCTGTGCCATCATT
CCTATAGTGACCAACTACACACGTTCCAAAAACTCGAATTGCTCTTATTGCTTTTTTACC
TGTGTCCCAGATTGTAAGTTTCAGCCTTTTCCCTCTTACTTACATCTGGTTGATCTTACA
GTCAACACCTACAATGTTATACTGATCAGACTCAAGCAGGCTTCAAATTCATATAAGCAT
CAAGACTTATGTTTTCCGAGTTTATTTTCAAACGGAGAATCATAAAGATAACTTCAAGTT
CTCCAACTTCAACTTCATTTGAATTTTGACCAGACAGTGG
GenBank Accession AL949319 [GenBank]
Graphic View Graphic view of gene At3g09910
Predicted Position of Insertion Chr3:3037341 - go to primer design
BLAST e Value 1e-130
Hit Clone Code (BAC ID) F8A24
Hit Gene Code At3g09910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RAB GTPase homolog C2B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL949318 [GenBank] AL949318 [GenBank]


Last Updated on 31.08.2016 09:40