SimpleSearch - Line and FST details


Line specific information

 
Line ID 319H06
Vector Used pAC161
Line Availability only available from NASC (N430618)
Segregation Analysis 100:96:83
Confirmed for Hit At2g28700
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g38430 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g38430

 
Sequence (A. th genome BLAST matches underlined)
>48-K015856-022-319-H06-8409
ATTTCCCGGACTGAAGCCTTTAATTGAATATCTTCCCACGTGGATCGATCCGTCGTACCA
GCTTTGCAATTCATACAGAAGTGAGAAAAATGGCTTCTATGATATCCTCTTCAGCTGTGA
CTACAGTCAGCCGTGCTTCTACGGTGCAATCGGCCGCGGTGGCTCCATTCGGCGGCCTCA
AATCCATGACTGGATTCCCAGTTAAGAAGGTCAACACTGACATTACTTCCATTACAAGCA
ATGGTGGAAGAGTAAAGTGCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACT
CCTTCTTCGATGAGAGCCGGCGGCTATGGGATCCTCCCAATAGTGAGANNNTNTATNCNC
CCCACATACTCCTCTATCTTTGGANAAAAAGAAACAGAAAATTT
GenBank Accession FR807834 [GenBank]
Graphic View Graphic view of gene At5g38430
Predicted Position of Insertion Chr5:15385201 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) MXI10
Hit Gene Code At5g38430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribulose bisphosphate carboxylase (small chain) family protein
Insertion Classification TS2TE (5')
Confirmation Status failed

Gene hit At2g28700

 
Sequence (A. th genome BLAST matches underlined)
>48-K015860-022-319-H06-8409
TATCCTGTAATTTCCCGGACTGAAGCCATTTACATTGAATATTTCCCGGACATGTAGAAT
TCTAGAATGAGGAGGAACTCCCTTCAGCAATAAGAAGTGGTGTCATGCCTTCATTTACTA
CAGTTGTTGCCATGGTTCCAGTTGTAGCGGTTGGTGCCATATCCATTAATGAATAAGATT
CTCCGATTTCAAAATTTGGATTGGTGAGGGTTACATTTTGATGATGATAAAGATTTCTAA
GATAGTGATCAATAAACTTACATAAGTCAAGACGATCATTATCATTCATAACAAAATCTC
CCATGTTCCCACCATGACACTTGAACATGACCTCCTTTAAGCAAGTCTCCTTATTTTCTA
CAATTAATTTCTTACTTTGCTTTTCGACTTTTGAGATGTATAGATTGAGAAATTCTTCGT
GGTTCACCGATTTAACTTTCTTTTGGGTCTCCGGTAACATCTCAAATTTCTTGATGATAT
TATTCACCTCCGATTGTGATGGCCACACATCTGGATCTGAGTTGAATGGATTGTACACGA
CCGCACATGCATTAACATCGCATAAAACCTTGAGATCATTGAGTGTCTTCAGAAATCCTT
CTCTCCTCTGCTTGAACGATCTTTTCCTCATTCGATCATTGAAAATGTAAGTTATATTTA
ACTTTTTTCTTGCCATGACTACACTATGGGACTCCCCCCAATAAGAGAGAGGANCTTGAG
TCCAACCCGGTAAAACACGACTTATCCCCACTGGCAGCAGCCACTGGTAACAGGAATAAA
CAAAGCCAGGTATGTGAGGGGGGGCACAAAAATCTTTTGAAAGGGTGGCCTAACTACGGC
TACCCTAG
GenBank Accession AL949325 [GenBank]
Graphic View Graphic view of gene At2g28700
Predicted Position of Insertion Chr2:12318104 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T8O18
Hit Gene Code At2g28700 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 46
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23