SimpleSearch - Line and FST details


Line specific information

 
Line ID 320D03
Vector Used pAC161
Line Availability only available from NASC (N430663)
Segregation Analysis 50:49:39
Confirmed for Hit At2g40000
Parent of DUPLO pair 912
Parent of pair(s) none

Gene hit At3g14330

 
Sequence (A. th genome BLAST matches underlined)
>20-K015944-022-320-D03-8409
CCTTTTCATTGTATATATCCGGAAGATTATTAGTCATTGAAGAACCGGTACTGATCGGCT
CGACAGGGAAATACTTTGTGTCTTTGTTCAGATCTAAAGGATGATTGATTCAGATGTCGA
AGTCGATTTCCTTAATACAGAGAGTATTGGATGTATCTGCTCGCATATGTATATCCCAGA
CAGGCGGACCTTTATTATTGGTGGTGGCATCTAATTTATACATAAGGAGAACCCGTGGTT
ACAAAATATTTCTGGCTATTCTTATGCTGGCGATCCTCCCCATAGACAAAGAGCTTCTTC
TATGGGATCCTCCCTATAGAGAGAGTTCCAATTACGATTACCAAGAATCTCAGAGTATGT
GCAGACTGTCATTCATGGATGAAGATTGTGTCACAAGTAGCTATGGGATCCTCCCTATAG
TGAG
GenBank Accession AL949387 [GenBank]
Graphic View Graphic view of gene At3g14330
Predicted Position of Insertion Chr3:4780137 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) MLN21
Hit Gene Code At3g14330 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g40000

 
Sequence (A. th genome BLAST matches underlined)
>20-K015948-022-320-D03-8409
ATCGACGGGCAAAAACGATGCGTTTTGTTTCGGATCTAAAGGATTAGTGGAGATGATGAA
GATGTCCAAAGATCTGAGACAGAAAGTACCGGCGGACTTGGCCGCTGAGGGATATCCAGC
CGGAGGACCAATATTACAAGAGGCGGCGATGAAGCTTTACGCGAGGAAGACCGAGTGCGA
TAATATTCATTTGCTTCAGGGGATGCAAGCGGCGGCAGCGGCGGTAAACAGTTTCTTCTT
TGGGTATAGGCAGTTAGTGGCGGCTATGATGGGAAGTGCGGAGATGAACGCGACGGCGAG
TCAAGAGTCGTGTGACTCACTGAGTCAGATATTTATGGAGCCGACGTATTTCCCGAGCCT
TGACGCGGCAAAGACGTTTCTGGGAGAGCTTTGGAGACATTTGCGATGATTAAATTTTAA
TTTCTGCTGGGATAATTATTTAATATAAATTTAAATTGGTGGTTTGGTTTAATTTAGGTT
GCAAGATAGTGAAATTTTTGGAACATTTGACGATCCATATTTGAATACAAATTCATTTTT
ATATGATTTATGAGATTTTTTAACAAACGATAACATTTACGAATATCCGTATCCATACTT
TTGATTATCCACCAGTCCGTATTTCAAATATGGGTGGCCTACTAACGAGGAACGACTAAT
CTTTATGCTCTGACTAATCGTCAACAAATCACCCCCATCCTTTGTAGATGTTAGTGTATG
AAAAAAACCCAATTGCCCACCTCATCCTTGGGAAAGGTAAATTCTGAACAAAACCCATTT
TCC
GenBank Accession AL949388 [GenBank]
Graphic View Graphic view of gene At2g40000
Predicted Position of Insertion Chr2:16701086 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T28M21
Hit Gene Code At2g40000 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ortholog of sugar beet HS1 PRO-1 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23