SimpleSearch - Line and FST details


Line specific information

 
Line ID 321C02
Vector Used pAC161
Line Availability only available from NASC (N430746)
Segregation Analysis 100:99:98
Confirmed for Hit At1g68590
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g68590

 
Sequence (A. th genome BLAST matches underlined)
>11-K015949-022-321-C02-8409
TATCCTGAAATTTCCCGGAATGAAGCCATTTACATTGAATATATCCCCATTTTTCTCCAC
CCAAAAATGTGACCATATCTTCCTTATCCATATTCTCACAAAATCTCCATTGTTCTCTGA
GAAAACACAAAAATGATGTCATCAATGGCACTCTCTTCTACTTCCCTCTGCTCTTCTTTC
ATCTCTCAACATCCAAAACTCTCCATCACTGCTTCTCCTCCATTGTTCCATACCCAAACA
ACCAAACCCATCTCTGTAAAACGGAAAATCATAACCCTATGGGATCCTCCCCTATAGTGA
G
GenBank Accession CR396440 [GenBank]
Graphic View Graphic view of gene At1g68590
Predicted Position of Insertion Chr1:25758247 - go to primer design
BLAST e Value 1e-121
Hit Clone Code (BAC ID) F24J5
Hit Gene Code At1g68590 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein PSRP-3/Ycf65
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396439 [GenBank]


Last Updated on 31.08.2016 09:40