SimpleSearch - Line and FST details


Line specific information

 
Line ID 322B02
Vector Used pAC161
Line Availability only available from NASC (N430830)
Segregation Analysis 80:74:72
Confirmed for Hit At5g52470
Parent of DUPLO pair none
Parent of pair(s) 2831, 10824

Gene hit At5g52470

 
Sequence (A. th genome BLAST matches underlined)
>10-K015950-022-322-B02-8409
TAAATCATCATCTGCCGATTTCATTGTACTGATTTTTTTAAAAGCAAAAGATGCAATGCA
ATAAAAAAAAACTTTGAAGATATAACTGTAAAATAAAAAGGCTTCAAACATTTCATAGTA
AATGAAATGTCATCATATGCCGATTTCAATGAACTGATATTTTAAAAGCAAAAGATGCAA
TGCAATATGACGTAACCTTTGTGAATAAAACTGTAGAAAGGGTAACTTCAAACTTTCATA
GTAAGAAATATAGAACCAAACCTGATCTGGCTGAGCAACATCAGAGAATATGACATCAAC
CATGCCCACGAGCATTCTGTACTTAGCCGGATGCCTATGGGATCCT
GenBank Accession BX890976 [GenBank]
Graphic View Graphic view of gene At5g52470
Predicted Position of Insertion Chr5:21295751 - go to primer design
BLAST e Value 3e-159
Hit Clone Code (BAC ID) K24M7
Hit Gene Code At5g52470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation fibrillarin 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890975 [GenBank]


Last Updated on 07.07.2016 14:03