SimpleSearch - Line and FST details


Line specific information

 
Line ID 322B04
Vector Used pAC161
Line Availability only available from NASC (N430832)
Segregation Analysis 50:46:41
Confirmed for Hit At5g19430
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g19430

 
Sequence (A. th genome BLAST matches underlined)
>26-K015946-022-322-B04-8409
TTTCTTAGAAGAGGTTTCTGATCCCGTAACATGCTATTTAGAGTGAAGTGACTTGCCCAG
GACGATAGGACATGCGATCTCTTGTGGCGAACTGCAACGTACCGGATCTGTGTTGCCTCT
TGCCGCTTGGTTGTCAGGCTTTTTGTCTTAGCACACGCTGTATGAATATATCTTCGTTGC
ACGTCTCTCAGACTGAGTTGGGCTGTGTCCCCCTACTCTACTCCGGATTCCTTACGCTGC
ACCAAAAGAGGTAACTATAGCCTCTGACTCCCATCCGCTAACACATCGATTTATTGTCTC
TAGTCAGATTTCGCTGCCATGAGGATCGATACAGAGATGTAGGCAGGCCATGCTACGAAC
TTCGTGATTTGGGGGCCGAACCACCGCTATCCTGTCGATGCTGNCCTTTTATTGAGTACA
TATTCTCGTCGCATGATGAAAATTTTCTAATTTGAAATATGGTTGCTTTGTGTGNCGGTC
TTGTTTCAGATTTGGAGCTGATTCTGTCCATGATGCTTCTGCTTCTATGTGGAAATGTAT
CTATGGATCCCCCCCNTTATAGGAAGAAAAGGGAACAGNGAAGGGCTTGTATCCCACTTT
GGGGATTTAGTGGAGC
GenBank Accession AL949629 [GenBank]
Graphic View Graphic view of gene At5g19430
Predicted Position of Insertion Chr5:6553671 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) F7K24
Hit Gene Code At5g19430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g09330

 
Sequence (A. th genome BLAST matches underlined)
>26-K015950-022-322-B04-8409
TGTCCTGTAATTTCCCGGACATGAAGCCATTTACAATTGAATATATTCGAGGATCTATTC
AATAATCGACTCTTATGTAGAGAGGTGGCGAAACCCTAACAGGCTATATAGATACCAGGC
GCTTCCCCCAGGAGGCTCGCTACATGCGCTCTCCTGTGCCGACCCTGCCGATTACTGGAT
ACCTGTCCGCCTTTCTCCCTTCGGTAAGCCGTGGTCGCTCTTCTCATAGCTACACGCTGT
AGGAATCTCACTTCGGTGCACGTCGTTCACTCCGAGCTGGGCTGTGTGCACCAACCCACC
GTTCAGGCCGACCGCTGCACCTAATGGGGGAACTATCGTCTTGAGTCCAATCCGGTAAGA
CACGACTTATCGCCACTGGCAGGTGCCACTGGCAACAGGATTAATACAGCGAGGTATGTA
GGCCGTGCTACACAGTTCTTGAATTGGTGGCCTAACTACGGCTACACTGTGCGATCTCGC
CATTAGTGAGATCATAGACGCCTCGCATGCCGAAAAGATGCTTATATGAAACATGGTGGC
CTTGTGTGCCAGGTCTTGTGATCAGATGGAGACCTGAGTCTGTCCATGATGCTTCTGCTA
CTATGTGGAAATGTGCCGATGTGTCCCACCCAATAAGTGAGAAAATGGAGCAGGGAGGTC
TTGTAGCCCAGTTTGGGGATTTAATGGAGCAGTGA
GenBank Accession FR807864 [GenBank]
Graphic View Graphic view of gene At5g09330
Predicted Position of Insertion Chr5:2893034 - go to primer design
BLAST e Value 4e-19
Hit Clone Code (BAC ID) T5E8
Hit Gene Code At5g09330 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 82
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23