SimpleSearch - Line and FST details


Line specific information

 
Line ID 322C03
Vector Used pAC161
Line Availability only available from NASC (N430843)
Segregation Analysis 50:38:34
Confirmed for Hit At3g05380
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g05380

 
Sequence (A. th genome BLAST matches underlined)
>19-K015946-022-322-C03-8409
TGTCCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGTAAATCACGTGGG
GCTTGGTCACATTCCAAGACTTACTCGTCTTGAATGGAGCGTCATTAAAAGGTTTGTTCA
AGTTATGTTATTGGATACTTCCAGAGAATATAGGTAGATTATAAAAGGTTTCTTTCGTTT
TTTTGCAGTTCTCTTGGTAGACCACGAAGATTCTCTGAGAGATTTTTACATGAAGAGCGG
GAGAAACTTAAACAGTACCGCGAATCTGTGCGAAAGCATTATACAGAGCTTCGAACGGGT
GCTATGGGATCCTCCCTTAATAGTGAG
GenBank Accession AL949642 [GenBank]
Graphic View Graphic view of gene At3g05380
Predicted Position of Insertion Chr3:1544170 - go to primer design
BLAST e Value 1e-130
Hit Clone Code (BAC ID) F22F7
Hit Gene Code At3g05380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ALWAYS EARLY 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL949642 [GenBank]


Last Updated on 31.08.2016 09:40