SimpleSearch - Line and FST details


Line specific information

 
Line ID 323B07
Vector Used pAC161
Line Availability only available from NASC (N430931)
Segregation Analysis 50:49:40
Confirmed for Hit At5g67250
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g67250

 
Sequence (A. th genome BLAST matches underlined)
>50-K015947-022-323-B07-8409
TGTCCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGTTTTTTGACCGTG
AAGTAGTGTCTTGAGAACGTGAAGTTTGACCGTTGAACACGAGAAGTAATGATGGTCGCA
CAAGAAGAGCGTGACGAGAGGTTATAAATAAAGAGCAAAAAAACAAAAAAGTTAACAAAG
TCGAAGTAATCAACGATCACGATTAGCTCAACACTTATTTTAAGATCTGACGGTTGAAAA
GAAAGTGAATAAAGCGCGTGCGAGTCTGAGTTGGGTCAAGCGTGTCGACTACGATTATGA
CACGTGTTCCCTTATTTGACGGGATGAGCCGTTACTGTGTGTACTTTATAATTCCTCAAA
CCAAAAAAACAACAAAAAATAAAATAAAGGGAAAAAAAAAAATTTGGAGAGGAAAAAAAA
GGAGGAATTCGAA
GenBank Accession AL949748 [GenBank]
Graphic View Graphic view of gene At5g67250
Predicted Position of Insertion Chr5:26833650 - go to primer design
BLAST e Value 3e-137
Hit Clone Code (BAC ID) K21H1
Hit Gene Code At5g67250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SKP1/ASK1-interacting protein 2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences


Last Updated on 31.08.2016 09:40