SimpleSearch - Line and FST details


Line specific information

 
Line ID 323B07
Vector Used pAC161
Line Availability only available from NASC (N430931)
Segregation Analysis 50:49:40
Confirmed for Hit K21H1
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit K21H1

 
Sequence (A. th genome BLAST matches underlined)
>50-K015947-022-323-B07-8409
TGTCCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGTTTTTTGACCGTG
AAGTAGTGTCTTGAGAACGTGAAGTTTGACCGTTGAACACGAGAAGTAATGATGGTCGCA
CAAGAAGAGCGTGACGAGAGGTTATAAATAAAGAGCAAAAAAACAAAAAAGTTAACAAAG
TCGAAGTAATCAACGATCACGATTAGCTCAACACTTATTTTAAGATCTGACGGTTGAAAA
GAAAGTGAATAAAGCGCGTGCGAGTCTGAGTTGGGTCAAGCGTGTCGACTACGATTATGA
CACGTGTTCCCTTATTTGACGGGATGAGCCGTTACTGTGTGTACTTTATAATTCCTCAAA
CCAAAAAAACAACAAAAAATAAAATAAAGGGAAAAAAAAAAATTTGGAGAGGAAAAAAAA
GGAGGAATTCGAA
GenBank Accession AL949748 [GenBank]
Graphic View Graphic view of sequence AL949748 of line 323B07
Predicted Position of Insertion Chr5:26833650 - go to primer design
BLAST e Value 3e-137
Hit Clone Code (BAC ID) K21H1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23