SimpleSearch - Line and FST details


Line specific information

 
Line ID 323G04
Vector Used pAC161
Line Availability only available from NASC (N430988)
Segregation Analysis 100:95:58
Confirmed for Hit At3g54220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g54220

 
Sequence (A. th genome BLAST matches underlined)
>31-K015947-022-323-G04-8409
TATCATGTAGATTTCCCGGACATGAAGCCAAGTTTCCAACTTTCTCAGCTAAAGGGCAGA
ACTCAAAAGGCAGGCCAAGCTTATCTGCGAAATCCGAAAGACGTTTCCCTGTAGCCTGAA
GAGCTTCCATGGAAGTACCAAGTCCCGTGAGTCGCACGTGTGGAGGTCCTCCAGGTCTAT
GGGATCTCCCCTATAGTGAGANNNCNNNNNTNCAGTNNNCNCCTCTTTGTTTCTATTTCA
AAACTGANATAACCCTCTAATTATTATATAAATGTAATCTGTAATTGCACTTGATCATAT
CCATATAACCAGATACTGTTTGCATGAGTCCTTTGCATAGGTGCAATGATCACCATCTTA
TATGTCGAGATCAAATTTATCTTGCTATGGGATCCTCCATATACTGAGACAGATGTGACT
GGAGGATAAACTGCGTTTACCTGTACATGATTATTTTGTGTTTGATAGATCATCACGTTG
ACCATCAATATTGGATCCATCTCCCGAGTCGTGCTAAGCTATACTGTCCATATTCTGAAA
CCTATTGTTCTGTGCCAACTAGGGGATTCTGCCTATGACGAGCAAGGTCTGTTAGCAGTT
TACTCCTTGTTAGCCTAAAATGGAAAAAAGGCTGTGATTGCGACT
GenBank Accession AL949819 [GenBank]
Graphic View Graphic view of gene At3g54220
Predicted Position of Insertion Chr3:20071969 - go to primer design
BLAST e Value 1e-80
Hit Clone Code (BAC ID) F24B22
Hit Gene Code At3g54220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40