SimpleSearch - Line and FST details


Line specific information

 
Line ID 324D11
Vector Used pAC161
Line Availability only available from NASC (N431055)
Segregation Analysis 100:77:56
Confirmed for Hit At3g56400
Parent of DUPLO pair none
Parent of pair(s) 1384

Gene hit At3g56400

 
Sequence (A. th genome BLAST matches underlined)
>65-K118834-0022-324-D11C-35St
ATCCACTATCTTGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACAG
GGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAACTATCAGTGTTCTTTTAC
TCAAGTATAGTCGACTCTATAGTACACGTCTCCGATCTCTTTCTGCTCATAATATTAATG
AAATCAATTAATCATTTGGCTACTTATGATTCTTGCAACCAAAGCTAAATGTCTTGTTTG
TTTGTGACTAACCATAACAGTAAGTAAATCCTAGATGATAGTTTTTTCCATGAGTATGGA
TGATCACTAGATATATGGTACATATGATCAACGTAATCGGTCTAATAGAACTACGATGGA
TTGATTTTATATCATTATGGTTAATAATTGAGTAAGAGAGAGAAAAGGGCGAAACTTACT
TTCTTTTGTAGCATCCTCTTTTACCCTTAACGGGTCCCAATCTTTTCCGACTATCGCCGG
AATCTTCAAACTTGCCGTCGTTATCACATGAAGCATTTTGAGATCCCTCAACGGCGGCGA
GGGATGAGGAGGAGGAGATGGGTTCGAAGGTATCAAGAACGGAGATGGTGTTATTGAAAC
ACACTAAGATTTTAGCCACTAGATCCTCTAGACCGGACCCGGGTTGAGAGAGGAGTTGCT
GAAGCTGAGTTGTTAAGTCATGGCCTTCAACGAGTTGGTTCATAACTTTAAGCTTTTTTG
CTTTATTAGTATCCATTTGTTAGTTTTGAGGAAGTTTTTGGTGAGTGGTATCTTATTTTT
CTTTCCTCTTGGTGTGGTTTGTATGATTAAAGGAAAGAAGAGAAGTGTGTGTAAATATAA
GGTGGAAATAAGATTTGT
GenBank Accession HG968897 [GenBank]
Graphic View Graphic view of gene At3g56400
Predicted Position of Insertion Chr3:20909793 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T5P19
Hit Gene Code At3g56400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 70
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX890982 [GenBank] HG968897 [GenBank]


Last Updated on 31.08.2016 09:40