SimpleSearch - Line and FST details


Line specific information

 
Line ID 325D02
Vector Used pAC161
Line Availability only available from NASC (N431142)
Segregation Analysis 100:90:70
Confirmed for Hit At2g02860
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g02860

 
Sequence (A. th genome BLAST matches underlined)
>12-K015977-022-325-D02-8409
TGATCATGAGATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGATACTCATTGC
TGATCATGCATTGATGCATGCATGTCGACTCTATGGGATCCTCCCTATAGTGAGACTTCG
TCGTTCTCTGAATCTGCTTCTCCTTCGAATCATTCTGATTCGGCTGATGGTGAATCTGTG
TCGAAGAATTGTAGTTTAGTGACGTTGGTTCTTAGTTGTACAGTTGCCGCTGGAGTTCAA
TTTGGTTGGGCATTGCAACTTTCTCTTCTTACTCCTTATATTCAGGTACTTACTATTACT
CTTGTCATTGTTACCATTTCTATCACTTGTGGCTTTCTCTATAGCAATTTAGATTCGAGG
GTTTTGTTCTTGTGTAGCTTTGTACGAGAAAGTCGAGTACTTTGTAGGTGAATCAATGAA
TTCTAATACTTAGGTTAGGTAGTTGTTGTCACCAACATAGCCATGAGATATTTTCGTATG
GAACTCTATAGCATTGGCTTATCGAAGAGTATATGACATTGGAATTTAGCTATGG
GenBank Accession AL950037 [GenBank]
Graphic View Graphic view of gene At2g02860
Predicted Position of Insertion Chr2:832256 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17M13
Hit Gene Code At2g02860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sucrose transporter 2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03