SimpleSearch - Line and FST details


Line specific information

 
Line ID 325E04
Vector Used pAC161
Line Availability only available from NASC (N431156)
Segregation Analysis 75:65:47
Confirmed for Hit At3g12690 At2g41040
Parent of DUPLO pair none
Parent of pair(s) 4388, 7299, 93907, 93908

Gene hit At3g12690

 
Sequence (A. th genome BLAST matches underlined)
>29-K015977-022-325-E04-8409
GCCATTTACATTGTGCAACGTGGCTCTGTTTCCCTGCCCCTTGCACGGGGTGGTCCCATG
GAGGAGCTCATAAAGGAAGATCCCGAATGTCCACCAGTCCACAGCGCTGCCATGTCCCTC
GCCACGTATGATCTCTGGAGCTATGGGATCTCCCCTATAGTGAGATCCCTATANTGAGAN
NTGNNCTTNCTTTTTATACATTGCTGGAATCTCAGGATCCTTCCAAACGGGCCGACCGCC
TGTGGGACCCTCTTTGGGACGCACAGTCGGCATAAGCATCTTCAACAATGGCCTTTCCTT
TATCGCAATGATGAGATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAGAAG
GACAGATATCTGGGCAATGGAATCCGATGAGGTTTCCCTATATTACCCTTTGTTGAAAAG
ACTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTAGATATTTTTCGAATAGACAAACT
AGTCTTGCTCCACCATGGTGACTAAGATCTTCTTCTTGTCCTTGAAANCTAAGAGACTCT
GTATGAACTGTTCGCCAGTCTTTTACGGGAGTTCTGGTTAGGCCTCTATTTGAATCCTTT
ACCCCATGGGAATTGGGG
GenBank Accession BX942962 [GenBank]
Graphic View Graphic view of gene At3g12690
Predicted Position of Insertion Chr3:4030948 - go to primer design
BLAST e Value 1e-68
Hit Clone Code (BAC ID) MBK21
Hit Gene Code At3g12690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGC kinase 1.5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g41040

 
Sequence (A. th genome BLAST matches underlined)
>29-K015984-022-325-E04-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGTATCGTTAATAT
AGCTGTAATATACATGGGTTCTGTTGACTCTGGTCATGCTGGTGCAGCCTGGCACTGTTG
GCCTTCTCCTACAAATGCTGTAAGTTCTTGAATATGTCAGAGCTTCATGAGTGTATGCAA
ATGGTCACTTGTTAAATTTGTCTTTGTGTTGTTGTTTTCAAGATTGCTGAGATCTGTCGT
GTTCTAAGAAGCGGAGGTGTGTTTGTCGGGACAACGTTTCTCAGATACAGTCCTTCGACT
CCTTGGATTATTCGTCCTTTCCAATCGGTAAAGAAAATTTATAATGATCAAAAGTGGCTA
TTTCTATGCATAGATTTTGATCTTTATACATTTTGCATTTTTGCAGAGAATTCTGCAGAG
CTACAATTACTTGATGCAGGATGAGATCAAGGATGTGTGCACATCATGTGGTCTCACAGA
TTATGAAGATTATATTCAGGATTCTTTTATCATGTTTACTGCTCGCAAGCCCTAT
GenBank Accession BX890983 [GenBank]
Graphic View Graphic view of gene At2g41040
Predicted Position of Insertion Chr2:17122588 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T3K9
Hit Gene Code At2g41040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03