SimpleSearch - Line and FST details


Line specific information

 
Line ID 326A05
Vector Used pAC161
Line Availability only available from NASC (N431205)
Segregation Analysis 100:96:64
Confirmed for Hit T20K14
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T16L1

 
Sequence (A. th genome BLAST matches underlined)
>33-K015985-022-326-A05-8409
GATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGACAACAAAT
TAATGATTATGTCCCCTGGATACTGGCGATCTACACCACATAATGCCATCAATTATTTAG
CACCTATCAAATAATTGTCACGGTTGTATATATGGCGCGCCTATGGGATCCTCCCTATAG
TGAGATGACCGCTATTAAGTTGTCCCTATGATTGCATCACTGTA
GenBank Accession AL950116 [GenBank]
Graphic View Graphic view of sequence AL950116 of line 326A05
Predicted Position of Insertion Chr4:16208677 - go to primer design
BLAST e Value 5e-34
Hit Clone Code (BAC ID) T16L1
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit T20K14

 
Sequence (A. th genome BLAST matches underlined)
>33-K015978-022-326-A05-8409
TGATCTGAAATTTCCGGACATGAAGCATTTACATTGAATATATCCTGAAAAAGAAACAAA
GTAATTTCCCGGGGATCCATGGAAACTTCTATGGGATCCTCCCTATAGTGAGAGGAAAAG
ACACCAAGTTTGCCCCTCGTTTTTCATGATAACATGTTGGGGCCCCTCCCAAAAGCGAAG
GATTCACCCACTGGATCTATAGGATCTTCCCTATGGTTATGTTCATGTACAGAAGCTACA
GCTATATAAACAAAATCATGAATTTTCAATGGTTTCGCTGAAAAAAAGTAAGGCAAAGGA
CGCGAGGTCGTCACGATCAACACCGGCAAGGGCTGCATGATCTGTGTCTATGGCATACCA
AAGAAGCGAGGCATAAGCCCCTTCACCGTGAGCATATCATCGTGTACCTCGCCTCTGACA
GTCACTGCAATAGGCGGGATATGCTTATTTGCACGGAACCATTCCTACTCGAGACTCATG
ACCTCCCACACGCTATGGGATGCTAAGACATGCGGCGGTCTTTGAGTGCAGTGTATGCGT
CCCAAGCGACTGAGACTTGCTTCACAGTGGTGGGGCTCATGGGCTGGAGATGAAGTGGGT
GGTCCCAGTCGAATTTGTTCATGGGTAAGTCTCTTTGGATCTGCTCTTCAGTGACTTGTG
GGTCGTAGATGCTGAGACGAGCCTTGTCACCTANCAGACCTTTGCAGACATCAATGGCTG
GAGTCTCTCTA
GenBank Accession AL950115 [GenBank]
Graphic View Graphic view of sequence AL950115 of line 326A05
Predicted Position of Insertion Chr5:5027620 - go to primer design
BLAST e Value 1e-108
Hit Clone Code (BAC ID) T20K14
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03