SimpleSearch - Line and FST details


Line specific information

 
Line ID 326D01
Vector Used pAC161
Line Availability only available from NASC (N431237)
Segregation Analysis 100:88:75
Confirmed for Hit At4g08310
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g64860 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At5g18610 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g64860

 
Sequence (A. th genome BLAST matches underlined)
>04-K015985-022-326-D01-8409
TGATCTGTAGATTCCNGGACATGAAGCCTTTAAATTGAATATATCCTGAGGAAACTGACC
ATCTGATGTGCTTCATGTATCGAGGACAAGCTATTAAATTGAATTTACTCATTGATAATT
ATCGTCGATGACGGTTTAGTAGACACCCTAAAAGAGACTCACTCTGAGATGAGTTTCTCC
ACGGAGACTTTTCGAAGAAGGAATTGCATCTCTTCCTAAGGGATCCTCCCTATAGGGAGA
AACTTCCCCAAGGAGGAC
GenBank Accession CT026262 [GenBank]
Graphic View Graphic view of gene At1g64860
Predicted Position of Insertion Chr1:24100247 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) F13O11
Hit Gene Code At1g64860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sigma factor A
Insertion Classification CDSi
Confirmation Status failed

Gene hit At4g08310

 
Sequence (A. th genome BLAST matches underlined)
>04-K015978-022-326-D01-8409
AAACCCGATCGGTTACAGATATTTCAGGTACAAAAGGTTAGAACGCCTGTGGCATATTCT
AAGATGTCCGCTCGATATCAGTTCTCATCAAGCCGGGTTCGGATTAATATGGGTATAAAT
TTTTGGGCACTATTTTGGAACTTAATGGCAAATATCCGCATTTATGACTAACATTTCCGG
GTTTAAGCAGAATTCAAAGTTTCAATTAAGATATCCCGGTATTTTTAGTTCTGGGCCCAA
GGTACGATTTTTCGGATACAATAGTTCTTGACCTCCATAGAGATAAACATCTAATTCAGA
TTCGGCTCTAGATCCAACTTTTCGGTCCTATTTCGATTCGGGTTGTTGGTTTCGGGTTTT
TTTCCCAGCCCTACTCATCACTTCTTCAGTCTGGGAAGCGAGGACATCCAACAGGCTAAA
ATTAGCGGAACCACATGAGGACAAGGACGCTAAACTATCTAGGTTATTTGTGTGTTAATC
AGCTTAATATAACTCTATACCCAACCAGAACTATAATAACCTTGGTATCCAGAACAGACT
TTTTAATTGCCCTCCTTCAACGAA
GenBank Accession AL950157 [GenBank]
Graphic View Graphic view of gene At4g08310
Predicted Position of Insertion Chr4:5252201 - go to primer design
BLAST e Value 2e-104
Hit Clone Code (BAC ID) T12G13
Hit Gene Code At4g08310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA ligase
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g18610

 
Sequence (A. th genome BLAST matches underlined)
>07-K020163-022-326-D01t-8409
AAATCCTTTCCGCCCTTCTCCGAAGCTGGCCCTATGGGATCCTCCCAATAGTGAGTAGCN
AAGNTAAGNATGTATACAGCTGTCACCACGACGCCGATCAGCGGTCTTGTCGCTGCATCG
CTCCTGTAAACACATTGCTGCAACTGCAAGTGCTCGAGATAAACCACTCATTGGATACCG
CCCTAGCAGCGATGGATCCGCCATCTTCCGAAACTTTCTACAGATCTTTGAACAACGGCC
TATGGGATCCTCCCTATAGTGAG
GenBank Accession BX530868 [GenBank]
Graphic View Graphic view of gene At5g18610
Predicted Position of Insertion Chr5:6195084 - go to primer design
BLAST e Value 2e-52
Hit Clone Code (BAC ID) T28N17
Hit Gene Code At5g18610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 088H03
Other FSTs Supporting this Hit BX530867 [GenBank]


Last Updated on 31.08.2016 09:40