SimpleSearch - Line and FST details


Line specific information

 
Line ID 326G12
Vector Used pAC161
Line Availability only available from NASC (N431284)
Segregation Analysis 100:99:81
Confirmed for Hit At3g50890
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g50890

 
Sequence (A. th genome BLAST matches underlined)
>23-K020162-022-326-G12t-8409
ACAAGCAAGCAACGAAGAGAAACAATAGTAACATTAGTGAATCGTTTGACGATCCGATAA
AAGTGAAATAAATTTTTACAATCCTCGTTTGCTTTTATCACACATTTTTCGCCCTTTCAA
ATTACTCAAAATCTTCGAGTATAAATCTGTGGAATCTTGTACGTTTTGATTGTTTTATAT
TGTATCTGGGATTATTTTTTTCTTTTACTTAATTTGTGGTTGAACAAAGTGATAAAATTG
GACCTTCAAATAAAGAGGGAAAAACGTGTGTAATTAATAATTTAATGCACAAGTATGGTT
AGTACAATTAGCTGGAATAGCTTAGTTGGTTAGAGCGTGTGGCTGTTAACCACAAGGTCG
GAGGTTCGACCCCTCCTTCTATGGGATCCTCCTATTAGTGAG
GenBank Accession CT026267 [GenBank]
Graphic View Graphic view of gene At3g50890
Predicted Position of Insertion Chr3:18917112 - go to primer design
BLAST e Value 4e-159
Hit Clone Code (BAC ID) F18B3
Hit Gene Code At3g50890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein 28
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT026268 [GenBank] CT026266 [GenBank] CT026266 [GenBank]


Last Updated on 31.08.2016 09:40