SimpleSearch - Line and FST details


Line specific information

 
Line ID 327D04
Vector Used pAC161
Line Availability only available from NASC (N431336)
Segregation Analysis 50:50:31
Confirmed for Hit At3g26450
Parent of DUPLO pair none
Parent of pair(s) 5887, 5936, 5961, 5979, 6025, 7685, 7712, 7732, 8771, 10501, 75780, 75789, 75790, 75791, 75792, 75793, 75794, 75797, 75798, 75799, 75800

Gene hit At3g26450

 
Sequence (A. th genome BLAST matches underlined)
>28-K015979-022-327-D04-8409
TATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATAAATATGACAATA
ATTTAATTTACACGCTTTAACAAAAAAAAAGAAAAAAATAATGATTTACTTGTATGTAAA
GATGGAAAGGAGGAGGTATTCAAGGAGAGGAGAGAGATAGACGATGACAATAAGATAGTG
AAGGTTGTAGGATTGGAAGGTCACGTGATGGAGCAGTTCAAGGTGTATGAAATTGACTTC
CAATTTATTCCCAACTCTGAAAAAGATTGCGTCTGCAAAATCACTATGATATGGGAGAAG
CGCAACGATGATTTCCCCGAACCAAGCAGCTACATGCAACTCCTCAAGAGTATGGTTATT
GATATGGAGGACCACGTCCTTAAAGCTTAATCAATATCACAACCACCACCATCATCACAA
CCACCATCACCATCATCCTATATATTTATTAAATTGTTTTCATTTATATATAATAGGCTA
TGG
GenBank Accession AL950287 [GenBank]
Graphic View Graphic view of gene At3g26450
Predicted Position of Insertion Chr3:9681940 - go to primer design
BLAST e Value 3e-159
Hit Clone Code (BAC ID) F20C19
Hit Gene Code At3g26450 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Polyketide cyclase/dehydrase and lipid transport superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL950288 [GenBank]


Last Updated on 14.10.2014 10:23