SimpleSearch - Line and FST details


Line specific information

 
Line ID 327H08
Vector Used pAC161
Line Availability only available from NASC (N431388)
Segregation Analysis 50:47:36
Confirmed for Hit At2g33560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g33560

 
Sequence (A. th genome BLAST matches underlined)
>64-K015979-022-327-H08-8409
ATATGGCANGTGACTTTGTGATCCCAATATTTTTTGGGCTATGGGATCTTTCTTATAGTG
AGAGNGNAGGGGAATGACTCGNNAGGGGACGTCTTCTGTCACTTAGCCAGCGCACCGCCG
ACATTAAGGGGCACAACGTGTGATGATGAGGAGATAGATCCATCGTGTCTACGACTGGTG
ATCGGCCACTCTGGATATCCACCCTTGATAGAGGTGGAAACATGTTTTGTTCAGAAAACT
TCTGAAAAATTAGTCAAACTTACTCTGTACATTCTTCTTCATCGACAAAAACCTCAAAGG
TGGAAGCAGATGCTGCTGCAACAGTTCTCACAATGGGTTTCTGAGGAACCTGTGACAATA
AATATAAATGCAGTTAGTGATCAATTTATAGAGATAGTATGAGCCAAGTGAGATAGTTTT
GTTTACGAGGGTAGAGGGAAAACCTTGAATGATGCCCATTTTCTATGGGATCCT
GenBank Accession AL950364 [GenBank]
Graphic View Graphic view of gene At2g33560
Predicted Position of Insertion Chr2:14213888 - go to primer design
BLAST e Value 2e-138
Hit Clone Code (BAC ID) F4P9
Hit Gene Code At2g33560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BUB1-related (BUB1: budding uninhibited by benzymidazol 1)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40