SimpleSearch - Line and FST details


Line specific information

 
Line ID 330E08
Vector Used pAC161
Line Availability only available from NASC (N431640)
Segregation Analysis 100:94:77
Confirmed for Hit At4g38520
Parent of DUPLO pair none
Parent of pair(s) 3872, 3955, 4042, 80967, 80974, 80980, 80989, 80990

Gene hit At4g38520

 
Sequence (A. th genome BLAST matches underlined)
>61-K016036-022-330-E08-8409
ATTTCCCCAGTCCATCTGATGCACATATAATGAACTGATCGTGCGGCTCCAGTGTATGCA
CCGTGATCGCCGGCTCTGCACTCAGTAATGGCTTGCTGAACGGTGACCTCACTCCGGAAT
TTTGCATACAGCGGTTCCCTGTTGAACTCTGACCTTTTCAAATACACATCACCAATGGAT
CTTGAAACCTGAGTATAGTCATAAAGCCACTCAGAAAGACAACAGGAATTGTAAGACATA
CAAAAACAGATTTAGTCCAACTCTATGGGATCCTCCCCTATAGTGAGAGNNNNNGACCTG
GCGCANCNNCGANCGGNTAAAACCCCCTCTTGGCTATGATTAAAACAAGAGCTTAAAGTC
TGTCAAAGCATGACTCATAAATCGCTATGGGATCCGCCCTATACTGAGAGTCCTAAGCTT
CTCATGGTAGCCTCATGAATTGTACCATAGGGATCCGCGAGTACGTTGCGTTGGCCACGT
ATAGCTTCCCATCGCACATGACCACTTACAGACAACATGCATCCCACTGTGGCTATCTGA
GGGCTATGGAATACCTCCCTCTGTGAGATCAAAAGAACCCAGTAAACGCGTGCCCCATAG
TCGAACATATACGCCCCAGGCGCCATACCCGGGGCAACTGGACGTATATATTTGCCCGTT
TTGCACAAAGGGCGATGGCAGTCGTTTGAGGCCGGGAGAAAGAGTTCCACGGGAAAGCTG
CCCGCAATAGAATACGCGGCCCGCATCCGCCATCTAACTAAGGACCGCAAAAGAAAGGCG
GGCGAAAACCGACATAAACGCCGCTTAATAAAGCGCGCTCGTCTAAGCGCAGTCGCGCTA
TAGCGCCCACAAGGAA
GenBank Accession BX942964 [GenBank]
Graphic View Graphic view of gene At4g38520
Predicted Position of Insertion Chr4:18016418 - go to primer design
BLAST e Value 3e-134
Hit Clone Code (BAC ID) F22I13
Hit Gene Code At4g38520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein phosphatase 2C family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23