SimpleSearch - Line and FST details


Line specific information

 
Line ID 332A10
Vector Used pAC161
Line Availability only available from NASC (N431786)
Segregation Analysis 100:98:77
Confirmed for Hit At1g22460
Parent of DUPLO pair 2655
Parent of pair(s) none

Gene hit At1g22460

 
Sequence (A. th genome BLAST matches underlined)
>73-K016064-022-332-A10-8409
TGTCCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGTCGCCGCTGCC
CCTATGCATCCCTCGAATTTGTGGGAGGCTATTGAGAGGTGCTTCAGATATGGGTACTGG
GACAATACGGAGATTGACATTACGTATATCGGCCCATGTTAGCACCCTCAGTATCACTAT
CGCTACCACAACCGACTTCCTCCGCCGCCGTGTTTCTTATGTGAACTATTGACACGGATA
CTTTCATGAATGGCAAAGCTCTCTGCTAACAATGGAATTCGAGAACCGGTATGTAGTGTC
AACGTCTTGCACTGTATGCACTTGTAGAGTGACTGAGACTTCCTATGACTGAGACTAGAG
ATTAGCCGAGACAGGTGAGTATGAGATGCCAATCGCTCATCTCGTGACACGATGATGAAT
GCCACCTAATCGACGATCTTTTTCCAAAGTTTAGTTTGGCCTTTTCGCTTGTTTTCTATT
TTAAGAGTTAAGAAGCTAAACAGGTTAGAGAAGGGTCACGTGACGTTTGACCTGTCCTAT
GGGATCTCCCTAATATGGAGAGGGAGAATTACGAACTGCCTATGAGAGTAAGGTGGCTCT
TAGAGTCTACACCATAGGTTTCTCCCCAAAAAGAAGAGTAACCACGTGAGGGCCGAAGGG
ACTGCATGCATAACAAAGGCGGATGACCGCGCAAGATGCCCGGGGGACCCCCGGGAAGGG
GGGACGGTGATGAAACTGGGCAGGGGGAAAGAGCGACGGTGAAAGAAGAGGAAAGAAAAC
CAGGGGNGAGGCGAACGCAAAAGACACATCAAATGAACGAGACA
GenBank Accession AL950887 [GenBank]
Graphic View Graphic view of gene At1g22460
Predicted Position of Insertion Chr1:7930465 - go to primer design
BLAST e Value 7e-55
Hit Clone Code (BAC ID) F12K8
Hit Gene Code At1g22460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX530872 [GenBank] BX530872 [GenBank] AL950887 [GenBank]


Last Updated on 31.08.2016 09:40