SimpleSearch - Line and FST details


Line specific information

 
Line ID 332F09
Vector Used pAC161
Line Availability only available from NASC (N431845)
Segregation Analysis 50:49:35
Confirmed for Hit At2g28780
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g15630 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g15630

 
Sequence (A. th genome BLAST matches underlined)
>70-K016064-022-332-F09-8409
GACTACAAACCAGTCTCTCCTTACGGGACCAGAAGCACCTCAATACCTGCCTCAACCACT
ACTATTGAACTTCGAACCAACCATTGGATGACTAAGATAGATTCTGAACATCCTGTCTGA
TCACCAGCGTATCACTGGAATGCTCTATGGAACGAAGGGATACATGGATTAATGAGTGGA
AGCTGGACCTTCAGGGAATGTGCAATCAGAGGTTTTGCTACAGAAAGATCAAAAGACTTT
TACTTTCAAGCAAGGTTGGGCTTTTCCTATGGGATCCTCCCCTATAGTGAGANNNNNNNN
NNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNANNCNNNNNNCNNCANNCAAN
ANNNCCNNCCGGCNNANCAACACCACCCAACCACCAACCCCAAAACAAAAACTATCCACA
ACNAAACAAAACACCCCCACACACACCCACACAAAAAACCACCCCCCCCCCANCANCACA
TAAACCAACANCCAAANAACACCACCGACAATCCAACAAAACAAAACAAACCT
GenBank Accession AL950967 [GenBank]
Graphic View Graphic view of gene At5g15630
Predicted Position of Insertion Chr5:5086063 - go to primer design
BLAST e Value 4e-53
Hit Clone Code (BAC ID) F14F8
Hit Gene Code At5g15630 [TAIR] [MIPS] [SIGnAL]
Gene Annotation COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 329F09

Gene hit At2g28780

 
Sequence (A. th genome BLAST matches underlined)
>70-K016059-022-332-F09-8409
TTTCCCGGACTGAAGCCTTTACATTGAATATAAATTATTAGTTTTCTATTTTATTTTTCT
TAATATTATCATAGAATCCCATGCCATTGCTAGTAGGTTGATTTAATACTGTCAAAGAAG
AAGTATATAATCTTATAGGGATTATGTTAATTAATCAAAAGGGAATCATATTTTGTCTGT
GATGCGACACAGTTTGTTCGCAATATTGGGAAGAATTAAGACAAAATTTTCGGTGGTTGC
TGACATAAGTAGGATTTTATATGTAATAATGTGGTACGGAATAAAGTTAGCAACACACTT
TAATACCCACGTCAACGTGTTTATGTGACTGTATTACCAAGTCCACCAACATGTTTGTTC
CTCAAATCTATTTCTAACACGTATATATATGTACAATGGTTTATCAAAAAAAAAATATAT
ATGTACTATGTCTCAAAAATCTTTAAATTTTTAACCAACCTAATCATTCCTCTTTTAAGG
GAAAAACCATCTCAAATGATGTAACATTATTCTAAATCGGGAAAATTCTAAATATAGCTA
CTTTGGTTTTCACATGCAAAAATACAAACACTTAAGTTAGTGTTTGAAACAATAAAGACC
GTACTTCTACGACTAAGTACGTAGAGAGTAACGTTACATATACGTAAATAATTCAAGTTG
GGATAATTTGATATATTGAAAGTGATGAGAAAAAGGGTACCTCGACAGTACCCAACCGAG
GTAGTGGGACGAGTAGTGCAAAAACCAAGCTAAACACCAAGCG
GenBank Accession AL950966 [GenBank]
Graphic View Graphic view of gene At2g28780
Predicted Position of Insertion Chr2:12342075 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F8N16
Hit Gene Code At2g28780 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23