SimpleSearch - Line and FST details


Line specific information

 
Line ID 333F04
Vector Used pAC161
Line Availability only available from NASC (N431936)
Segregation Analysis 50:50:38
Confirmed for Hit At5g63390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g63390

 
Sequence (A. th genome BLAST matches underlined)
>30-K016060-022-333-F04-8409
TTTCCCGGACTGAAGCCTTTACATTGAATAAAAGAAATTACCATTTTGCTAATCACCGAT
TCGGGGCTAAACTTATAATAAAATTAAATTACGGTCCTTATTCATAAGAAGATATAAAAC
CAGGGGGCAATTTGAAGTTTCTCGGTTCGTTAGTACTTCGTACTTGGCTTCTTATTTTCC
CGGGAAAACAAGAATATCAGAAGTCTCTGTAACTGAATCTCACATATCTCTCTCTTTGCA
CAGAGAACCAACTGAGAAACTTTCTTCAACGATCGAAAGAAGCTGCTTCAATGGCGAAAT
CGATGAGAACTATCAAAAATCCATTCTTTACTTCGCATCCGCCATCTCCATTCTTCCATC
TCTCTCTCCTCTTCTTCACTCCCCTGAAGAAATCAAGTCCCCGATACCTAAACCACCATC
ACCAAACTCGATGCCCACCTCCACAGTTTTTCCTTCTTCTCATCTCTCTTTCTCTCGTTT
TCTCGGGAATTTCATTTCTCACATTTTCTTTAGACACTGGATCGTCAACTTGCGTCTCCA
CATCTTCCGCTTCCTCTCTCAAATTCTTCATCTCCGATGTCGATCACCGTCAGATCTTAA
CCTCCCTTGCTGTATCCGGAGCTTCCACGTTGTTTCCGTTACCGGCGAGAGANGGAAATT
TCGGGGAATATGACGGAGGAAGAGAAAGAGTTTTGGAAACAACCCAATGGTGAGGATACA
AGCCTTGTTTGGATTTTAGTTTGGAGACAAGAAGAATCAGTATGCCCCCCCCCCCAAAAA
AGAGAGAGGNANCNCCNNNNNNCCNNNNNNNNNNNNNCCGAAAGAGAAAAAAAACACGGA
GenBank Accession AL951092 [GenBank]
Graphic View Graphic view of gene At5g63390
Predicted Position of Insertion Chr5:25392833 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K9H21
Hit Gene Code At5g63390 [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23