SimpleSearch - Line and FST details


Line specific information

 
Line ID 333F04
Vector Used pAC161
Line Availability only available from NASC (N431936)
Segregation Analysis 50:50:38
Confirmed for Hit At5g63390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g63390

 
Sequence (A. th genome BLAST matches underlined)
>30-K016065-022-333-F04-8409
CTGTAATTTCCCGGACTGAAGCCTTTACATTGAATCTACTGTTGCGAACCTGTTGTTTAT
TCCGTTAGCGCTTGACCGGTACGTAAGTTCATTAGCTTCTCTCTGTCTAAAGAAGAAATC
TACTCTCGTCTCCTATCGTCTGTTCATGCCTTGGATAATGACCCTCTTATGATTACCTTA
TTCCGAGGAAAATAACGATTAGACCAACTTCTTATTTGGAAATGACACTGCCACCGTCTA
TTATACTCAGGATCAACGACGTCTTCTCCGTATTTCGATTATAACACTGATGAAGGAAAG
GCGCAAGGACTAAGAGCTATCACTGATCTTCCGCATATGATTGGATTAAATAGACGTGTC
TCTCTCCTGTCTTAACGAAAAGATTGGATTCTGACCAGAGGAGATGACCTACTTGGGGAC
CCTATGATCCTGACTGTGCTTTTTTCTCCTCTGATGTTACTTCTTGGGAAACCTTCTCGG
CCTGAATGTTGGAGAAAACGGTCTTCTTTGACAACCCATGAGCCTGACCTATGGGATCTC
CCCCTATAGAGTCGAAAGATACTCTGCACGAACTGTTCGTCCCCGATGTACGATCGACGT
CTGATACGTCCTCTATCTTGATCTATCCACTCCATGCGAATTGGGGGATCCTCTCCGGCG
ACAGGAGGGAATTTTGCCGGTAATATGACGGGAGGAAGAAGACAGAGTTTTGGAAACGAC
CCAATGGTGAAGGATACCAGCCCTGTTTTGGATTATAGTCTGCAATACAAGAAGAAATCC
GCTAG
GenBank Accession FR808107 [GenBank]
Graphic View Graphic view of gene At5g63390
Predicted Position of Insertion Chr5:25392888 - go to primer design
BLAST e Value 8e-30
Hit Clone Code (BAC ID) K9H21
Hit Gene Code At5g63390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR808107 [GenBank]


Last Updated on 31.08.2016 09:40