SimpleSearch - Line and FST details


Line specific information

 
Line ID 333G05
Vector Used pAC161
Line Availability only available from NASC (N431949)
Segregation Analysis 50:49:40
Confirmed for Hit At1g09440
Parent of DUPLO pair none
Parent of pair(s) 5037, 5058, 5158, 5167, 77184, 77199, 77204, 77206, 77208

Gene hit At1g09440

 
Sequence (A. th genome BLAST matches underlined)
>39-K016060-022-333-G05-8409
TGATCTGTNATTTCCNGGACATGAAGCCATTTACATTGTAAATGAAAGACAGAGAGTACG
ACAATGATGATCAGTGCAATGGTGATAAAGATGGCTTGCCAGATCTTAAGTCCAGCCATT
GTTCTCCTTCCTAATCTGCTATGGGCATCTCCCTATAGTGAGAATGAATCTGACNAATTC
TTGCTTATTTTGTTAATGGANAAAAACAGAGAGAATGGTTTGAGTAGTAGCCGGTCTGGT
TCAGGTAAAGAAGGTTATTTATGTGTTGCAAACCGGTCTACTTCATCATTGTATGAGATG
GCTACACCATCACCGTCACCTCTTTCTGGTTTACCTGAGTCACACCTTGGATGGGGTCAT
TGGTTTACTCTGAGAGATCTTGAGATATCAACAAACAGATTCTCAAAGGAAAATGTGATT
GGTGAAGGAGGCTATGGAGTTGTTTACCGAGGCGAGTTGGTCAATGGGAGTCTTGTTGAC
GTGAAAAAGATCCTAAACCACTTGTGAGTTATGGTCTCAGAGAAATGTACTCTCTCTTAT
TGATTTGATTTCTTTAGTTGATTATTCTTGAAGTTTGATTTTGTACGGGACAAGCNGAGA
AAGAGTTTACAGTAGAGGTAGATGCTATAGGTCGTGTGCGTCACAAGAACTTGGTACGTC
TTCTA
GenBank Accession AL951110 [GenBank]
Graphic View Graphic view of gene At1g09440
Predicted Position of Insertion Chr1:3047266 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F14J9
Hit Gene Code At1g09440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03