SimpleSearch - Line and FST details


Line specific information

 
Line ID 334D08
Vector Used pAC161
Line Availability only available from NASC (N432012)
Segregation Analysis 100:99:82
Confirmed for Hit T20D1
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T20D1

 
Sequence (A. th genome BLAST matches underlined)
>60-K016066-022-334-D08-8409
GATCCTGTAGATTTCCCGGACATGAAGCCATTTCCCGGACATGAAGTCAACTAAGATAGT
TGAAGTAATGTCTTAAACTAAAGTAAACCACCGGTCCAAACGTGGTCCGGAAGCATCTCT
GGTATGATTTATCCTAAAAATCAAAATAGTAGAAACATACTTTAAATATATACATTGATC
GGACGAAAATTGTAAACTATGGGATCCTCCCTATAGTGAGAAACCCGACAAGAAACGGAA
ACCCCAATCTCAAACCTAAAGGGTAAAAACCGTTTCGCCAAAGAAAACCAAATAAGGTAC
TAGGGTTCCCCCAAGGTCGGCATACAAACACGATGGCACGGTGAGGAAGGGTCCAAACGT
TAAAATGCCAAAATGTAAGAATGCGACCGAATTTT
GenBank Accession AL951191 [GenBank]
Graphic View Graphic view of sequence AL951191 of line 334D08
Predicted Position of Insertion Chr5:6591679 - go to primer design
BLAST e Value 1e-81
Hit Clone Code (BAC ID) T20D1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03