SimpleSearch - Line and FST details


Line specific information

 
Line ID 336D03
Vector Used pAC161
Line Availability only available from NASC (N432199)
Segregation Analysis 50:38:25
Confirmed for Hit At4g30930
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g30930

 
Sequence (A. th genome BLAST matches underlined)
>20-K016135-022-336-D03-8409
TATCCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGAGAATATCTTT
CCCGGTACATCGCTAATATTAAATGATCTATCAATATACTCCATACTCGGGACTACTGAA
ACTAGAGAGGGACTATAATGACGTAGAACAACAACCCGTTCTCTCTACTCAGTGTAAACC
CTATGGAATACTGCCCTATAAAGAGAAGTCGATGAACTCTATAAAACTCATAAACTACAT
ATAATCAGCATTGCTTGATTTCGAATCCAATGCTCAACAAAGTCCTATGGGATCCTCNCC
TTATAGTGAG
GenBank Accession AL951446 [GenBank]
Graphic View Graphic view of gene At4g30930
Predicted Position of Insertion Chr4:15051730 - go to primer design
BLAST e Value 4e-38
Hit Clone Code (BAC ID) F6I18
Hit Gene Code At4g30930 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L21
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23