SimpleSearch - Line and FST details


Line specific information

 
Line ID 337E01
Vector Used pAC161
Line Availability only available from NASC (N432305)
Segregation Analysis 50:47:43
Confirmed for Hit At3g25730
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F6N7

 
Sequence (A. th genome BLAST matches underlined)
>05-K016136-022-337-E01-8409
TGATCCTGAAATTTCCCGGACTGAAGCCATTTACATTCAACTTCGGAATTAAAGACACAT
ATCAATGAATATTCCTGATGAGGTTATCGAAAACGTACTTACGCCGCTATGGGAGGATAT
CATGGTATGGAAGTTTCAAGACACGGCACTCCATGTGGCTAAGGTTGACTGTTATTGCCA
ACACTCAACCAAAATATGGGGTTTGATACGCAAAAGATTGATGTCTACGGAGTTAATTCC
ACAACTCTGAAATTCGGAAAACTGGAACTTAAATTATGAAGACCTCTTCATATATTGGCT
TTCCACTATGGGATCCTCCCCTTATAGTGAG
GenBank Accession AL951615 [GenBank]
Graphic View Graphic view of sequence AL951615 of line 337E01
Predicted Position of Insertion Chr5:21371974 - go to primer design
BLAST e Value 7e-129
Hit Clone Code (BAC ID) F6N7
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g25730

 
Sequence (A. th genome BLAST matches underlined)
>05-K016158-022-337-E01-8409
TGATCCTGAAATTTCCCGGACTGAAGCCATTTACATTGTTATTTACACATAAATACATCT
CTCCAAGATTATCGCTGAAGAGAGATTCAATCAAAAAGTTTTTTTTTCTTTCCCAGGTTG
TTAGATTGGGATTACAAAACTACGTTGCTTCTTACGCCTTAACGACGACATTAACACCTC
CGTTGTTTCCTTCATCATAGCAACGACGGCGCTTTAAAGAAATATCAACCCCAAACAATC
TCATAACCCGCATCCCGTCTCTATGGGATGCCTCCCTTATAGAGAGAGACCTCTTCATAT
ATTGGCTTTCCGCTATGGGATCCTCCCTATAGTGAGATC
GenBank Accession BX285315 [GenBank]
Graphic View Graphic view of gene At3g25730
Predicted Position of Insertion Chr3:9397579 - go to primer design
BLAST e Value 1e-40
Hit Clone Code (BAC ID) K13N2
Hit Gene Code At3g25730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ethylene response DNA binding factor 3
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40