SimpleSearch - Line and FST details


Line specific information

 
Line ID 337F04
Vector Used pAC161
Line Availability only available from NASC (N432320)
Segregation Analysis 100:98:94
Confirmed for Hit At3g22470 At1g13260
Parent of DUPLO pair none
Parent of pair(s) 528, 3669, 9739

Gene hit At1g75700

 
Sequence (A. th genome BLAST matches underlined)
>79-K020162-022-337-F04t-8409
AGATTCTTGAGAAAGGTACTTCTTTATTACACTATTCTATGGGATCCTCCCTATAGTGAG
AGATTAAAATTTGTATTTGTTATCNATTTTTTTTCGAATATCAATGTATATGATCGAATG
ATTATTATAAACTCGCTAAGTATTGCAATTTGTTGTAGATTAGGTTAAATGGGACGGATT
ATCCCACTCTGACTTCTCCTATCTAAATCTTTAATTTTATTATTCAAAAAAATTACGCTA
TGGGATCCTCCCTATAGTGAGAATGGGATCCTCCCTATAGTGAG
GenBank Accession BX530879 [GenBank]
Graphic View Graphic view of gene At1g75700
Predicted Position of Insertion Chr1:28425226 - go to primer design
BLAST e Value 1e-29
Hit Clone Code (BAC ID) F10A5
Hit Gene Code At1g75700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation HVA22-like protein G
Insertion Classification 3' region
Confirmation Status unknown

Gene hit At3g22470

 
Sequence (A. th genome BLAST matches underlined)
>30-K016158-022-337-F04-8409
ATTGTGCCACCATTAAACGTGTGAAAGATGATTTGGAGTATAGGCTCATATCAAGCTATG
GGATCTACACTATAGTGAGANTCTTGAGAAAGGTACTTCTTTATTACACTATTCTATGGG
ATCCTCCCTATAGTGAG
GenBank Accession AL951639 [GenBank]
Graphic View Graphic view of gene At3g22470
Predicted Position of Insertion Chr3:7967932 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) F16J14
Hit Gene Code At3g22470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g13260

 
Sequence (A. th genome BLAST matches underlined)
>30-K016136-022-337-F04-8409
TGACATCTCCTACCTGAATCTTTGATTCTATAGACTCAAGTAACTACACTAAGACACCGT
CNNNTATCGTGACAACGCTAGCCCAACCCGCTTGCGCAAACAGTGCCTCCGCCGATCTAA
ACCCCGTCGTAGAAACACCATCATTACTCAACCCCGACGTTAACAACGTCCTATGGGATC
GenBank Accession BX001298 [GenBank]
Graphic View Graphic view of gene At1g13260
Predicted Position of Insertion Chr1:4543312 - go to primer design
BLAST e Value 2e-36
Hit Clone Code (BAC ID) T6J4
Hit Gene Code At1g13260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation related to ABI3/VP1 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX530880 [GenBank]


Last Updated on 07.07.2016 14:03