SimpleSearch - Line and FST details


Line specific information

 
Line ID 338F04
Vector Used pAC161
Line Availability only available from NASC (N432416)
Segregation Analysis 64:58:42
Confirmed for Hit At5g47640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g47640

 
Sequence (A. th genome BLAST matches underlined)
>30-K016137-022-338-F04-8409
ATGAGCATTTTACATTGATATATCCTGTATATGCATGTCGACCCTATGGGATCCTCCCTA
TAGTGAGANNGACAAATACTCNATTCTGTTGCTATTCCAGCAGCTGGCTTTGTTGGACTC
GTAGACTTATAAGGTTCCGTCAAACACTTCTACCCTATGGTCTTTAACACTGTCGTCACG
GGTTGTTTTACTTTTCCTCGTTGTCCCATACATGATTGGTGATGAGCTGCGGCAGTTCGT
TGCACTGATGCTGCTGCTTTCTCAGACTGCTACCGCCTCCAAGAATGCTGCGTTCCTCGC
CTACGTGAGCAACCATATAGAGAGTCTATGCTCTGGCGATTTCCTCACTCACCCTATAGG
ATCACCGTCTAGTGAGAGATTATTAGGTATCGTAAGGTGTAGATAGGTGGAGAAAGCGTC
GGGTACTCCCGCGGTGGCCTGTACATTGACAAACTCCAAGGGGATCCCTCCTTGTCTGCT
ATAGAGCATGACCCGTTCTTGCCGATCGCTCACTTAAGCCTGTTCGTGAATACGGTCTTG
CCCGCCAACGCCAAGATCTCTAAAGATGCCTAAGAGACGATGCAGGAGTGTGTCTCCGAG
TTCATCAGCTTCGTCACCGGAGAAGCATCTGATAAGTGTTCGAAAGAGAAGACGAAGACG
ATCAACGGAGACGATTTGCTCTGGGCTATGACTAC
GenBank Accession FR808182 [GenBank]
Graphic View Graphic view of gene At5g47640
Predicted Position of Insertion Chr5:19309047 - go to primer design
BLAST e Value 9e-79
Hit Clone Code (BAC ID) MNJ7
Hit Gene Code At5g47640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit B2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR808182 [GenBank]


Last Updated on 31.08.2016 09:40