SimpleSearch - Line and FST details


Line specific information

 
Line ID 338G09
Vector Used pAC161
Line Availability only available from NASC (N432433)
Segregation Analysis 100:75:53
Confirmed for Hit At2g36220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g36220

 
Sequence (A. th genome BLAST matches underlined)
>71-K016159-022-338-G09-8409
TATCACTGAAATTTCCCGGACTGAAGCCATTTACTTGTCTTGTCTGATTTTTTTGAGTGG
AACTCGTTTTGAAAAGTCGTTGGTGATGACGTGGCAGCTGATCAACGTTTTTATTCAGAA
AGAAACACGGGAACGCGAAAGCGGTGATTTCACACCCACCGCACTAGTTTTTGTATTCTT
CTATGGGATCCTCCCTATAGTGAGACAAGATGCCAGTCCTGTAATCCCGCGTACTTCACT
CTTCCTTAAGAAATCACCTCTCTACCATGTTTTTCCAGAGCACTTTGGCCTGATAATAAC
GTCCGTACTAGCCGATGACTAAGCGTCTTTCCGATTAAACCGAGGCGACCCAATCTCAGT
GTTGACACTTATTAATCGTGAATGCGATATGTTATGCTCCTCACACTAACANTATAAGAA
AATTTAGGAGAAGAAGGTTCCAGAAGCGAAATATCCGTCTTTATCCTTGACCCGACCCGT
TTCAAGATGACCCGGTTCTTGCCCGCGTGTCTCCGTTGCTTTGCCTCGTTGAAACACGTT
TTCTGCGGTTTAGGCAAACCGATGATCGACGCTTTGGATTTTAGTAAGAACCGTTGCGAG
CTTGGATTCGAGTTGGGATTAGAATTGAGAATCCCAGAGTTTCCTTTTTGTGAGTCTTTA
CGATCAAAGAAGGCGTTGTCGCTGAGCCACTCTATGGGAT
GenBank Accession CR356305 [GenBank]
Graphic View Graphic view of gene At2g36220
Predicted Position of Insertion Chr2:15193372 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) F2H17
Hit Gene Code At2g36220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03