SimpleSearch - Line and FST details


Line specific information

 
Line ID 339G08
Vector Used pAC161
Line Availability only available from NASC (N432528)
Segregation Analysis 100:97:71
Confirmed for Hit T20D1
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g10930

 
Sequence (A. th genome BLAST matches underlined)
>63-K016138-022-339-G08-8409
TATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATCCTGATATATGTTGAC
AGGTCCGACATTCTTGGTTAACAAAAAAAATATGTTACTAGGGCTGTGAAATTTTGGGTG
GCAAAATCCAAACCTTTTAGAACTTGGGTTCTCCTTATGGGTGGGTACTGTCCAAGGGGA
AAGAGGAGGATGGCACCAATATAATTTACAAATAAGTGCTAAACAAAACGCACACCTCTC
ACCAAAAAGATCCTCGGAACTGCCCCAATTTTGGTTTAATCCACAAGCTACGAGAAAATA
AAAACTACTTTGAGATATATTGTTTACTGAAACAAATTTTGAAAGAAAGGGAACCTCCCN
TTGAAGATCGTGCTTATGACCGCAATTGAAAACTATAGTTACCACCACAATATCCCTTCA
GATATATTACCTTGTGAAATTTGCGGGTGCGCCCAAGTATGCACATTCACACTGGGAAAC
GCAATTGACCTATGGGATCCTCCCTAATAGCGAGACCATGNTGACGAAGATTTTCTTCTT
GTCATTGAGTCGTAAGAGACTCTGTATGAACTGTTCCGCCAGTCTTTACGGCGAGTTCTG
TTAGGCCGTCTATTTGAATCTTTGACTCCATGGGAATTGGGGATCCTCTAGTATCGGCAT
GGGATCCTCTTCCAACCGACAATGGTGTAAATATAAGGTTGTAAGGGGAAAAGGAAAGTG
CTGTT
GenBank Accession FR808197 [GenBank]
Graphic View Graphic view of gene At1g10930
Predicted Position of Insertion Chr1:3653831 - go to primer design
BLAST e Value 4e-47
Hit Clone Code (BAC ID) T19D16
Hit Gene Code At1g10930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DNA helicase (RECQl4A)
Insertion Classification CDSi
Confirmation Status unknown

Gene hit T20D1

 
Sequence (A. th genome BLAST matches underlined)
>63-K016160-022-339-G08-8409
TATCCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATGAATTTCTTTGTGCT
CCATAACTACTAAAACAAATGAAGAATCAACTATGTAACTAAAAGGTAAAAACCAGTTTG
ACGAAATTAAAACAATAATGTAATTAGGTTCTCCTTATGTTTGGTTACGATACCAAGTGG
ACTGTGTAGGATGGTGCAAATATGAAATACAAATCACTGCAAAACAACACGCGCAGTCTC
AGTTTTTAGATCATGGCCCTGCCAGAATTTTGGTGGAATCCACAGCTATGGGATCCTCCC
CTTATAGTGAGANNTTNNNNNTNTNGNNNCTCCNNCNTTTTTCNGACCCTCCTCCCCTTT
CCNCTATCTACNCANTCCCCNCCCCCNTNNCTCTCCNNTGGAATCCAAAGATGTTTCCCC
ATATTACCCTTTGTTGAAAATGCTCAATTGTCCTCTGTGACTTCTGAGACTGAATCTCTG
ATATTCTTGCAGTAGACAAACGTGTCGCGCTCCACCAGTGGGACTAACATTTTCTAATGG
CCATGGGACCCGAAGACATACTGGTTGAACTGTTCTCCAGTCTTTACTGCCAGGTCTGAT
AGGACCTCTATTGGAATCTTTCACTCCATGGCAATTGGGGATCCTCTA
GenBank Accession AL951944 [GenBank]
Graphic View Graphic view of sequence AL951944 of line 339G08
Predicted Position of Insertion Chr5:6591855 - go to primer design
BLAST e Value 4e-130
Hit Clone Code (BAC ID) T20D1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40