SimpleSearch - Line and FST details


Line specific information

 
Line ID 339H05
Vector Used pAC161
Line Availability only available from NASC (N432537)
Segregation Analysis 18:10:3
Confirmed for Hit At4g12020
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g12020

 
Sequence (A. th genome BLAST matches underlined)
>40-K016138-022-339-H05-8409
AGATCCTGATACGCTGAAGCCGACTTCTCAAGAAGCTTGTTTTAATGTCAGATATCCGGA
TAACATGAGGTTCTACCTCTAAAACTTCAGACAGAAAATTCTCTCTCACAGCATCGTGAC
CTTTTACCTCAACTTCTTTGTGGAGGTCCTTAAGGACGACACAGGTCTCATATTGGACAG
AGATTTTGCGAAAGATCTCTTCAGCAATGGTTGTTTTTCCTATACCAACTGTACCCCATA
TACCAATGCTGCGAACATCAAGGGACTCAATGCATAGCAGTGACAAAATCTCCTCTACTT
GCATATCCATCCCAATCATGTTCACCTTATCAGCAGAACATAGCACCTTTAAAGCATCTC
TTACAATCTCATCTATAAGTTCAGATTCAGACCTGCGAGATTTTAAGAATAAAGTAGACA
ATACAAACATCAGACGAAAGAGAGGATAGTATAATAAACTTCTAATCTTCTATAGCCTTA
CTTTGCCAAATAAAAATTTATTCAATTCTCTAAAACCAAAGACTTTCTACATTTAGAACC
CAGGGATCACGTACTTATCTGTCAATGTGTAGCCAGGCATCTGAGTTATTTCCTTCNAAG
CAGCTTGCCATTTTTTTGGCTCATCTTGGAGATAAATCTCTCATAATTCTTGCTGTTACA
GACAAAATCATATGGTGATAGTCTGTAGAAAATTGGATAACCACTCGATCCTCTGTATGT
TGGTGTTCAAGAATGGTTTAGAGGTTCGAAGGGAATATGGGCTTGTTATACTATAATCAA
AACC
GenBank Accession CR356306 [GenBank]
Graphic View Graphic view of gene At4g12020
Predicted Position of Insertion Chr4:7205319 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16J13
Hit Gene Code At4g12020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g16230

 
Sequence (A. th genome BLAST matches underlined)
>40-K016160-022-339-H05-8409
TGATCTGTAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCGGTCATGAACACG
TTGCTGGTATCCTCGCTATCTTAAGCATATAGATTATTTAAATCTATTTCGCTCGCAGTT
ACTTTAAAAGTTTTTTACTGGCTATTAGTTTAACGATTTATGTCATTTTTTTATTTGCAA
GATTTTGTTGATTCACGAGTCTTAATGTTTATTAACATGATGAGCATTCATTAGTGCTAT
GTCCAATGAGACTATAATACTACTTTCTTAAAGACATTGGATTCCATGTATCTTCGTTAA
TCCCATTATTCATATTCGTATCATGATATAAACTTTTTTTTTGGTCCACCTGAAAACTTT
TCTATATTGCAGAATCACTACACTTTTTTTATGTACACTTTATGAGTGTGTATGCATAAG
TTGGTGATTGGTTTCACACGGATCATGACATTAGCTATGGGATC
GenBank Accession AL951956 [GenBank]
Graphic View Graphic view of gene At5g16230
Predicted Position of Insertion Chr5:5303669 - go to primer design
BLAST e Value 1e-170
Hit Clone Code (BAC ID) T21H19
Hit Gene Code At5g16230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant stearoyl-acyl-carrier-protein desaturase family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40