SimpleSearch - Line and FST details


Line specific information

 
Line ID 339H06
Vector Used pAC161
Line Availability only available from NASC (N432538)
Segregation Analysis 80:76:66
Confirmed for Hit At3g53520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53520

 
Sequence (A. th genome BLAST matches underlined)
>48-K016138-022-339-H06-8409
TTGCCTACATGTTTTATACTCATTTGCTTATATTAGCTACTGTTTTTGACTTGGGATTTT
GTCATTGGGCCATTCACACTATGGGATCCTCCNTATAGTGAGAAAAAGATCCCTAGGATC
GTCTGGGTCGATTATGGTATCCTCCCGATAGAGAGACCTTTATCTTAAACTTCGTTTAAG
ATTCGGTTACGGAAGTCACTAACCATGCGAGGCAGTTCCTCCCTCATAGAATCTTTGGTT
CCCAGTTCAACTGTTCCTTTGCTATGCTTATGTCTGGTTTCCTCTTGTGAAGATCGTCTG
CTGCGTTTGGTTCGAACTCTATGGTCGCGCTTGGGTCGATCACCTTCTTTTCTTCTGCAC
ACAAAGTTCCCATTTCATACACGGAATTGGCGTTTCTTTATGAGACATCTTAAACATTGA
TGCACATTTCTAGCGATGTACATAACCACCATATCGAACTGAATTTCCTTCAACTAAAAC
CGACCCAAACTTTCTTTAGATGAAAAGATCAAAAACGCTTCTGAAGTTTGGAAAGACTCT
TCCCCCAAGCTACACCCAACCGAGAACCTGAATGCACCAGGCCCCTACGTTTACCACTCT
GGGTTTCCTATCTCTTTTTTGCCCGAACATAAACGAAGAATGGATACAAATAAAGCAAAC
CTTCTGTAAATCCCCACCATTGCGGAATTCTCCCGGGCTCACCAAGGTGTAACGGTCCCT
TTATTATTCTCCTTCCAATAAAACGTACCGCTCCCTCCCCATATGGAGATCCCCCTAATA
ACGAGGCGATAGACCCTATGGCGCACCTTATACAAAATCCCTACCGTGTGGCCCTTTGTC
TCAAACAATCGATCTATATCCATGCCCCCTCTTATTTTCTTCTTTTCCC
GenBank Accession AL951957 [GenBank]
Graphic View Graphic view of gene At3g53520
Predicted Position of Insertion Chr3:19844158 - go to primer design
BLAST e Value 2e-141
Hit Clone Code (BAC ID) F4P12
Hit Gene Code At3g53520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucuronic acid decarboxylase 1
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g16230

 
Sequence (A. th genome BLAST matches underlined)
>48-K016160-022-339-H06-8409
TATCCTGTAGATTTCCCGGACATGAAGCCATTTACATGTCATTTATATATCTCCTCGCGA
TAATGTCGTTGTGATCCTCCACCTATACAGCGGAAAGCCTGACGACGGATCTGCATTCTC
AAAAAGATCCCTTGAGACTCGTCTGGGGCGGTTATAGGGATCCTACCTATAGTGAGATTC
TATTTGCAAGATTATAGTCGATTCTCGAGTCTTAATAGCTATTAACATGATGAGCATTCA
TTATCGCTATGTCCAATGACACTATAATACTACTTTCTTATAGACATTGGATGCCATGTA
TCTTCGCTAATCCCATTATTCATATACGTATCATGATATAAACTTTTTTTTTGGTCCACC
TGAAAACTTTTCTATATTGCAGAATCACTACACTTTTTTTATGTACACTTTATGAGTGTG
TATGCATAAGTTGGTGATTGGTTTCACACGGATCATGACATTAGCTATGGGAT
GenBank Accession AL951958 [GenBank]
Graphic View Graphic view of gene At5g16230
Predicted Position of Insertion Chr5:5303660 - go to primer design
BLAST e Value 1e-96
Hit Clone Code (BAC ID) T21H19
Hit Gene Code At5g16230 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant stearoyl-acyl-carrier-protein desaturase family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23