SimpleSearch - Line and FST details


Line specific information

 
Line ID 340A03
Vector Used pAC161
Line Availability only available from NASC (N432547)
Segregation Analysis 100:88:78
Confirmed for Hit At5g62890
Parent of DUPLO pair none
Parent of pair(s) 4979, 4984, 5012, 5040, 5044, 5094, 10208, 73602

Gene hit At5g62890

 
Sequence (A. th genome BLAST matches underlined)
>17-K016152-022-340-A03-8409
TTTCCCGGAATGAAGCCTTTACATGGAGTAATATATATGTAGGTCCACAATGGCTCAAGA
CTTGAAGTGATTGAGAAATTGACCTCTCTTGGCTTTTATGTTTACAAGTTCAAAACATGC
CTGCCGGTTGCTATGGAATCCTCCCTATAGTGGCGAAGAGATGAAATCAGAGAAAGAAAA
AATTCCCATTTCACAATGATAAAGCAGGAAGTAATCATACATCTATAGGGTTCGAGGGAT
CACTGAATCTGCCAGAGAGGATTATGGATATCGCTGTTGGCACGAATGTGTAGGAAGCTC
CAACAACAGCAGGCAATCTATGGGATCCTCCCTATAGTGAGAAGCCATCCTAATCCATCT
TGCTAATGTTCCTAATCCATCTTTGCTAATGTTCCGGTCTTCAAACAAGAAAGAGCTATG
GGATCCTCCCTATAGTGAG
GenBank Accession BX890989 [GenBank]
Graphic View Graphic view of gene At5g62890
Predicted Position of Insertion Chr5:25244893 - go to primer design
BLAST e Value 2e-80
Hit Clone Code (BAC ID) MQB2
Hit Gene Code At5g62890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Xanthine/uracil permease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g46880

 
Sequence (A. th genome BLAST matches underlined)
>17-K016161-022-340-A03-8409
ATTTCCCGGACTGAAGCGATTTTCGGTTTGAAGAAAAGCGTAGCTGGTTCGGGTATTGAC
TTTCTACTTGGTTTGACTCCTTTGAAATGTTTTGGCTTATTTGCAATTAATATGCTACCT
TCTTTATGCTTTTGGCTTTTTGTATTTATTACTTTGGTCTTGCCCTTAAATTAATTCTAT
ATAAAATATCGAAATGGGACGATTAATATTACCATTTTTAGCTAAAGATAATGTTTCTCG
TGGGGTTTGAATATCTGCTGGTTGAGTCTCATTTAAAGATTAGTATCATGCACATTAGAA
TTAACATATGTTAAAATGCTAATATCTGGCGATTGCGACAGACTTTATTTTAATTGTTAT
ATCATTATTGCGATACAATGATTAAGTTCGTGCCAAAAAAGTATTTAATTAGACAAAGAT
TCCTATGGGAT
GenBank Accession AL951968 [GenBank]
Graphic View Graphic view of gene At5g46880
Predicted Position of Insertion Chr5:19035730 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MSD23
Hit Gene Code At5g46880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox-7
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03