SimpleSearch - Line and FST details


Line specific information

 
Line ID 340G06
Vector Used pAC161
Line Availability only available from NASC (N432622)
Segregation Analysis 50:25:21
Confirmed for Hit At3g21350
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g21350

 
Sequence (A. th genome BLAST matches underlined)
>47-K016161-022-340-G06-8409
TATCAACTGATTCTGACAACATTGTTTTTTTCGTATCAATTTTCTATCTCGATCACAACT
CTTTTTCTGTGCTCTTCTGGGTCCGGCCAAATGACTCACTTCCATGGATTCCTCTCTGCT
CTCGGCGGCTACGGCCGATACCTTCAACGGCAATGCGGCGGATCAAATTCCTCCTCCGTT
ACAGCCTCCGGGAACGGATATGACTGGAATTTCCTTCAGGGATCAGCTCTGGATCAATTC
ATACCCTCTTGATCGTAACTACATCTTCGATTACTTCGCTTTGTCTCCTTTCTACGATAC
AACTTGCAACAATGAGATTCTTCGGAGAAGATCCATTCACCCTCTCGATCTCTCTCACCT
CTCGTAAGCTCCTCCTCACTGCTCTACAGATAGGGTTATGTTGAAACTCATAAAGGTTTC
AACTTTAGGTCGAATTAGGGTTTGGTCTCACCTGGGATACTGTTAGAGAAATGGAGATAG
ATTTAGGTGGAGAATTTAGTGACAATGTTTGATTGAAACCATTGTGATTATATTATGTAG
GAAGATGACAGGCCTATG
GenBank Accession AL952076 [GenBank]
Graphic View Graphic view of gene At3g21350
Predicted Position of Insertion Chr3:7517018 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MHC9
Hit Gene Code At3g21350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA polymerase transcriptional regulation mediator-related
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03