SimpleSearch - Line and FST details


Line specific information

 
Line ID 341B04
Vector Used pAC161
Line Availability only available from NASC (N432656)
Segregation Analysis 100:57:42
Confirmed for Hit At5g04530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g04530

 
Sequence (A. th genome BLAST matches underlined)
>26-K016162-022-341-B04-8409
TGATATGTAGATTTCCCGGACATGAAGCCATTTACAATTGCTGATCAAAGTGTGCAGGAA
ATGTACGGATTTTATAGAGTTAAGTGATATGGTCACTGGTCAGTTTTTTGTTTTCAAAAT
ATATTTTTTTCTACACCCGCTGTAAGTTAATTCTGAGACTTTTGACATAGACCTATTAAC
TCCTTTACCAACTACTTTTTTTGCTTTTTGGCAAAATTTTGCTGCGTATAAAAATATATC
AAAATATCACTGTGACGAACCTTTCTGTATGATAATTTCCTATGATTATTGACTATATAT
CCTTTTGGATGAATTTCAAGGTTTATCCTATAAAAAGAAATGAATTAAGCTTTTAACTCT
GGAGGATCGTTCATACTTTGAGTTAAATATATAAATTTGGTACTGGCCTATGGGATCCTC
CCTATAGTGAG
GenBank Accession AL952126 [GenBank]
Graphic View Graphic view of gene At5g04530
Predicted Position of Insertion Chr5:1293697 - go to primer design
BLAST e Value 2e-132
Hit Clone Code (BAC ID) T32M21
Hit Gene Code At5g04530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 3-ketoacyl-CoA synthase 19
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL952125 [GenBank]


Last Updated on 31.08.2016 09:40