SimpleSearch - Line and FST details


Line specific information

 
Line ID 342H06
Vector Used pAC161
Line Availability only available from NASC (N432826)
Segregation Analysis 50:40:18
Confirmed for Hit At2g33100
Parent of DUPLO pair none
Parent of pair(s) 4615, 4619, 4653, 7360, 92978

Gene hit At2g33100

 
Sequence (A. th genome BLAST matches underlined)
>48-K016154-022-342-H06-8409
TATCCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGTTGGTGGAATATA
TCCAGGTGGGTTGAATATATCTACATGTAGAACCGGAATAATGTTTAAGTTATGGTGGCT
TGTAACATAAGCATTACAATTTTGCTGTGTTGCAAATCAATGTAACAACTCACCATCGAA
GAAGACAGTATTGTGATTTGCATATCGATCTGATGGGTCGATTCCTTCGAACCGTTGTGG
AAACTGAATATAACAGATCCTGTCACCACCTCGGTCCATCATGAAACACATTCCTTCTTT
GATAGCTTTGGAGTTGTAGATGTAGTGATCACAGTCCAGATTGAGGATAAACGCGCCATT
GGATAATATGGCTGAAGCTCTAACCATACCATTCATAGCGCCGGCTTTCTTGTTGTGGTC
AAAACCTGGACGTTTCTCACGCGAGACATAAGCAAACATAGGTACACGAATATCAATCCC
TGTGAAATCTATGGGATCGCCNNTTTAAANGGAGAANGACNACNATGTCTCTGCTCCNCA
TTGAACTCTAACAGACTCTGTATGAACTGTTCGCCGGTTATTTAACGGTGAGTTCCTGTT
TCGCCCTCTATGACAATCTGTGACTCCATGAGAATTGGGGATACTCTA
GenBank Accession AL952375 [GenBank]
Graphic View Graphic view of gene At2g33100
Predicted Position of Insertion Chr2:14037929 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F25I18
Hit Gene Code At2g33100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cellulose synthase-like D1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL952376 [GenBank]


Last Updated on 07.07.2016 14:03