SimpleSearch - Line and FST details


Line specific information

 
Line ID 343E12
Vector Used pAC161
Line Availability only available from NASC (N432892)
Segregation Analysis 50:50:40
Confirmed for Hit At2g20740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g20740

 
Sequence (A. th genome BLAST matches underlined)
>93-K016155-022-343-E12-8409
TGATCTGAAATTTCCNGGACATGAAGCATTTACAATTGAATATATGCCTGTAGCAACATG
CTTCTATGGTATCCTTCCGATTTGGAGAAGACAGTTTTAAGATTCTTGTAAGATTTGTCT
TTCAAATTTGATGGCACTGGAAATGAGTGACACATCTTGTGTGGGGTGAAACTATGTTTT
TCCCGTGGAAAGATCATAAATTCTGTAAGCTTGAGGTGGCTATGGGATCCTCCNCTATAG
TGAGACTCCATGGGAATTGGGGATCCTCTATGGGATCCTCCCTATAGTGAGAGNGCTTCA
AAAAGTTTTCATACTTACTTAGAAGGGTGAGACTATGCGAGTCCGCTATGGGATCCTGCA
TATAGGGAGAGCACAAATCAAGCTTGACCAAGTATCTCTCTTTCCGTCCGTCCAGGGTAT
GGGATCCTCCCTATAGTGAGTGCGTTTTTTCATCCTGGGCCCAAGGATGGGAATCGTCCA
TGGGACCCTCCCCATTGTGAACAAGATTGGTGAGTCGTTGTGTCAGCGATTATGGTTTTG
CCGTTGGGTGTTGCAGGTCTTTTTGCGCCGTGTTCTCTCCCGTTCGGCGTCTTAGGGCGG
CAGCTCGTATCTACTTGCGCTTCCTATGTGGCGTTCGTTACGCGTGCTATTTCCTGTTCT
TTTGCGGCGTTCTCCCTTTCGTCTGCTTTTGCTCTTTTTGTTTTGTT
GenBank Accession AL952465 [GenBank]
Graphic View Graphic view of gene At2g20740
Predicted Position of Insertion Chr2:8936109 - go to primer design
BLAST e Value 1e-62
Hit Clone Code (BAC ID) F5H14
Hit Gene Code At2g20740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetraspanin family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR808342 [GenBank] FR808343 [GenBank]


Last Updated on 07.07.2016 14:03