SimpleSearch - Line and FST details


Line specific information

 
Line ID 345C06
Vector Used pAC161
Line Availability only available from NASC (N433054)
Segregation Analysis 50:50:46
Confirmed for Hit At2g31210
Parent of DUPLO pair none
Parent of pair(s) 93479

Gene hit At2g31210

 
Sequence (A. th genome BLAST matches underlined)
>43-K016233-022-345-C06-8409
TGTCCTGAAATTTCCCGGACTGAAGCATTTACATTGAATATATCCTGTTGACATCTTCAA
GTGACATCTTCGCTCACGTTCTGTAGTAAAAGGTTTGTTCTTTCGCTTCCCTCTTCCTTT
ACGCCTAATCTCTTTGCTAAACTCGATGATTCCGCTATCAAACTGAGCATTGTTATTTTC
ATCTCCAACATTAGACTCATCTCTTTGAGTAGTAGTATTGGTATCAATACCAAGCAAGTA
CCCTGAGTAGTCATTAGAAGGGATCAATGGAGGTTGTGGAGGAAGGTTTAAGTGAAAGAG
CGGGTCATACGTGAAGCAAGAACCCGCCATTATATCAGAGCTTGGTAATGACATAGAGCA
TCTATGGG
GenBank Accession AL952676 [GenBank]
Graphic View Graphic view of gene At2g31210
Predicted Position of Insertion Chr2:13297334 - go to primer design
BLAST e Value 3e-174
Hit Clone Code (BAC ID) F16D14
Hit Gene Code At2g31210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g59740

 
Sequence (A. th genome BLAST matches underlined)
>43-K016239-022-345-C06-8409
TGATCTGAAATTTCCCGGAATGAAGCCTTTACATTGAATATATCCTGTGGTCATCTTCTT
GCGACAGCTTCGCTCACGTTGGGACTGGTAAAGCGTGTCCTTTCGCTACCCTCCTTCTCT
ACGACCATTCTCCTTGCTAGACTCGATGACTCCGCTACTACACTGAGCATTGCTATTTAC
ATCTCCGCCATCCAACTCATCTCTTTGACCACAACCATTGGGATCAATACCCAGCGAGTG
CCCTGCATTATTCATTATAAGGGATATTCGGAGGATGTCGCAAGAGGGCTGAAGGAAAGA
GCGGGTCATATGTGACTAATAAGCCGTGGTTAGATCATAACTTGTTGATGACATTCATCT
GCTATGGAACACATCCTATGGAGTGTAGAATGTTTTTGGTTATATGTCACTGATTTGGNC
AATTCGCGCCATTTTGTTTTGACGCCATTGCTCTTGAAAGTTCGGTTTCTTAAACAAATC
CAACAAGAAAACTTTGAAAGCAGAAAATACAAAACATATTATATGTTGAGTCCTAAAAAT
TTAAGATATAAGAACTTGGGGATGAAACGGAAGGCTTTACTGGATTCAAGATAAAGAAAC
CCTAATGTAGTGATTCATCAAATAGACGATACAAAAGCTTGAATGTAACTGTTCATTCAA
ACTAACTTTCTTAACGGTTTCAGCGTCCATGGGACAAGAAAGAATTTGTTAATGTCATTG
TACCCACTGAATACAGATTAAGACCAAGTAGTACTTCGATTGATGTTTCAGGCATTCCTC
TNCAAGTCTCAGCTCTTACGACATCAAGAANGATATCTGGGAGCTGCGAAACGCCCATTC
AGATCTGCATAACC
GenBank Accession AL952677 [GenBank]
Graphic View Graphic view of gene At3g59740
Predicted Position of Insertion Chr3:22069236 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F24G16
Hit Gene Code At3g59740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification 5' region
Confirmation Status unknown


Last Updated on 14.10.2014 10:23