SimpleSearch - Line and FST details


Line specific information

 
Line ID 345E06
Vector Used pAC161
Line Availability only available from NASC (N433078)
Segregation Analysis 50:50:34
Confirmed for Hit At3g53640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53640

 
Sequence (A. th genome BLAST matches underlined)
>45-K016233-022-345-E06-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATTGTGCCGGACAGAGAGAGCGCGGGA
GAAAATCGAACCCTAACCCTAATTTTGCGATTGTCTATCTTTTCCGACGATCTGATGGTG
AGCGATAAGATAGTAGAATCAAGCCACCGCAAACACCGTAGGTCGTATTCTCCTTCCGAC
GAAGTCGTTAAATCTTCCAAGCGGCACAAGCACCATCATCACAAGCATCGACACAGTCAT
CATCTTGATGAGGACGGCAATGAAAAGAATGTTTATCCATTTTTGGGGAATCCTGGTAAC
GATGGTGAACTTGATTTGGAGGAAGGGGAGAATTTGAAGAAGAAGGGAAGCATTGATAGA
GAAAGCAATAGAGACAACTACAGAGGTAGGAGTAGTAGAGATAAAGCTATGG
GenBank Accession AL952710 [GenBank]
Graphic View Graphic view of gene At3g53640
Predicted Position of Insertion Chr3:19889007 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4P12
Hit Gene Code At3g53640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40