SimpleSearch - Line and FST details


Line specific information

 
Line ID 346F05
Vector Used pAC161
Line Availability only available from NASC (N433185)
Segregation Analysis 50:41:29
Confirmed for Hit At1g74210
Parent of DUPLO pair 572
Parent of pair(s) none

Gene hit At1g74210

 
Sequence (A. th genome BLAST matches underlined)
>28-K118837-0022-346-F05C-8409
CGGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCTCCATG
GATGATAAGATATCTGTTTCTATGAAGTCTGTGCCTTCTTCAATTGCTTTCTATCATAAG
AAAAAAAAAATGTTTTACTTCTTATCTTCGGAAATCATCAAAGAGAAGGAGATTGATCAA
GAAAGATCAACAGTATACCAAGTATGCAGCTGTAGTTTCTTCTGGGATCTCTCCATTGGA
ACCTCTGTGTGCGATGTTATAAGGACGTGAAGTCTGAAGTTGAAGCTTGACAGTTTTGGG
TCCTTTAACAGGGAGAGGGTGCA
GenBank Accession HG968908 [GenBank]
Graphic View Graphic view of gene At1g74210
Predicted Position of Insertion Chr1:27911187 - go to primer design
BLAST e Value 2e-148
Hit Clone Code (BAC ID) F1O17
Hit Gene Code At1g74210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PLC-like phosphodiesterases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g04781

 
Sequence (A. th genome BLAST matches underlined)
>38-K016240-022-346-F05-8409
TGTCCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGATCATACTACTAC
ATGGTGGAAGCCTCGAGGAGATAGCAGATCGCAAAAGGACATATGAAGTCCAAAGAGACG
ACATTACTGGCTATTTCACTTGGACGATACCTCAATTCCTCTTCTGTCCCTACGGCATCC
TCCTCTATAGGGAGAGCCTACGTTCCAATTCCTCGCTTCCAGATATCTCTTCAGACATGC
ATCTGAACAATACAGTGAACTCCTTCCAGAAAGCTGACCTATGAGAGCCTTAAGCTCTTT
GATCTATATCATAAAGATCAGAAAGCGTCTACGAATTAACTATGGGATCCCCCNTTATAG
TGAGAGGGTACCGCTCTCGCGGCCCGCACCGAAACTGTGCTTTACCCCTGTGGGATCCTC
CCTATAGAGAGAGGAGGAGGATCATTGCCTATTCAGTGTCCGACGCTGAATAACAGTGAC
TATAAGGCATGGTGTATGAGGATGGACGCTGCACTACTAGTGCCTAAAGGCTGGGGAACG
CTCGATCCTGCATTGGAGGAC
GenBank Accession AL952865 [GenBank]
Graphic View Graphic view of gene At5g04781
Predicted Position of Insertion Chr5:1386930 - go to primer design
BLAST e Value 1e-77
Hit Clone Code (BAC ID) T1E3
Hit Gene Code At5g04781 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03