SimpleSearch - Line and FST details


Line specific information

 
Line ID 347D02
Vector Used pAC161
Line Availability only available from NASC (N433254)
Segregation Analysis 41:26:20
Confirmed for Hit T1G11
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T1G11

 
Sequence (A. th genome BLAST matches underlined)
>12-K016235-022-347-D02-8409
TATCCTGAAATTTCCCGGACATGAAGCCATTTGATTACTTTATAATCAAATACAATAAAA
AAAGTGATACTTATATGTTGCTTACATTGATCGATTACACTGAAGAGACATGACAACGCA
TTTTGCTTCACGATCATGTATATACATAAACATGAAAGGTCCATTGGGACTTCGGAGTTT
CTCTTTTGCTCCTCTTTGGGCTATGGGATCTCCCCTATAGTGAG
GenBank Accession AL952955 [GenBank]
Graphic View Graphic view of sequence AL952955 of line 347D02
Predicted Position of Insertion Chr1:1278793 - go to primer design
BLAST e Value 5e-71
Hit Clone Code (BAC ID) T1G11
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23