Line specific information

Line ID 348C03
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Genome hit F24K9

Sequence (A. th genome BLAST matches underlined)
>19-K016247-022-348-C03-8409
ATGAGCATTTACATTTAANGATGCTCTTTTATGTTCTTTAGTCTCTATGAGGAGCATATC
ACAGCATATTTCCT
GenBank Accession AL953065 [GenBank]
Graphic View Graphic view of sequence AL953065 of line 348C03
T-DNA Border not detected
BLAST e Value 5e-13
Hit Clone Code (BAC ID) F24K9
Hit Gene Code  
Gene Annotation  
Insertion Classification  
Confirmation Status unknown