SimpleSearch - Line and FST details


Line specific information

 
Line ID 349A06
Vector Used pAC161
Line Availability only available from NASC (N433414)
Segregation Analysis 50:50:40
Confirmed for Hit At5g43810
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g07689 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g43810

 
Sequence (A. th genome BLAST matches underlined)
>41-K016248-022-349-A06-8409
TGAAGACTTTGCAATTGAGTATGAATTTTGGAGTCGGGATATTCTCCCTTTAATGCAATC
TGACATTTTCTTATAATTATTTTTTGTTTGTACTTATTTTTCTTTCATCCTCATGATTTT
GCAGGTAGAATAAGGCCAAGGAAGGGATCAGTTTTAAGTTTTGTTTCATTCTTTTTGTAG
TGGAGAAAAAGAGTTTTTGAAAATCCAAACAACAAAAAATGCCGATTAGGCAAATGAAAG
ATAGCTCTGAGACTCACTTAGTTATCAAAACCCAACCTTTAAAGCACCACAATCCAAAAA
CCGTTCAAAACGGTAAAATCCCTCCTCCTTCTCCTTCTCCGGTGACGGTGACTACTCCGG
CGACGGTTACTCAGAGTCAAGCTTCTTCACCTTCACCACCGTCAAAGAATCGTAGCCGGA
GGAGAAACCGTGGTGGAAGAAAATCTGATCAAGGAGATGTTTGTATGAGACCTATGG
GenBank Accession AL953165 [GenBank]
Graphic View Graphic view of gene At5g43810
Predicted Position of Insertion Chr5:17611757 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MQD19
Hit Gene Code At5g43810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Stabilizer of iron transporter SufD / Polynucleotidyl transferase
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g07689

 
Sequence (A. th genome BLAST matches underlined)
>41-K016244-022-349-A06-8409
CATTAAATTTATATCAAATCAACCTTTGCACAGTGAAGTNAAAATGTTGTTGTTCTATGG
GATCCTACTTATAGTGAGACTAGACACAATTTGCCGTAATGCTGAATCTATGGCGAATGC
ATCCATCGTCACTAATGCATATATAAAGATACCAATTATGAAAGACTGAATTCCTTCTAT
GGTTCCACATGACCAAACCAGTACGAATATAACCTACATGCCATATTGAACTATGAGCTA
TGGGATCCTCCCTATAGTGAG
GenBank Accession AL953164 [GenBank]
Graphic View Graphic view of gene At2g07689
Predicted Position of Insertion Chr2:3336506 - go to primer design
BLAST e Value 1e-46
Hit Clone Code (BAC ID) T18C6
Hit Gene Code At2g07689 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NADH-Ubiquinone/plastoquinone (complex I) protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 31.08.2016 09:40